ID: 963349206

View in Genome Browser
Species Human (GRCh38)
Location 3:144132036-144132058
Sequence CCCACTAGGCCCCACCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963349197_963349206 -3 Left 963349197 3:144132016-144132038 CCCCCATGATTCAAACACCTCCC 0: 21
1: 716
2: 7107
3: 12325
4: 13203
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data
963349200_963349206 -6 Left 963349200 3:144132019-144132041 CCATGATTCAAACACCTCCCACT 0: 15
1: 206
2: 3239
3: 10688
4: 14108
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data
963349195_963349206 21 Left 963349195 3:144131992-144132014 CCTAAGCCATTCGTGAGGAATCT No data
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data
963349199_963349206 -5 Left 963349199 3:144132018-144132040 CCCATGATTCAAACACCTCCCAC 0: 28
1: 784
2: 7370
3: 12700
4: 12069
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data
963349196_963349206 15 Left 963349196 3:144131998-144132020 CCATTCGTGAGGAATCTGCCCCC 0: 2
1: 41
2: 398
3: 997
4: 2102
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data
963349198_963349206 -4 Left 963349198 3:144132017-144132039 CCCCATGATTCAAACACCTCCCA 0: 27
1: 833
2: 7637
3: 12911
4: 12982
Right 963349206 3:144132036-144132058 CCCACTAGGCCCCACCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963349206 Original CRISPR CCCACTAGGCCCCACCTGGT GGG Intergenic
No off target data available for this crispr