ID: 963351811

View in Genome Browser
Species Human (GRCh38)
Location 3:144160844-144160866
Sequence CTGTATCCACAGTTAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963351807_963351811 28 Left 963351807 3:144160793-144160815 CCTAACTACTTTGTAGGTGAAGA No data
Right 963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963351811 Original CRISPR CTGTATCCACAGTTAGAATG TGG Intergenic
No off target data available for this crispr