ID: 963351811 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:144160844-144160866 |
| Sequence | CTGTATCCACAGTTAGAATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963351807_963351811 | 28 | Left | 963351807 | 3:144160793-144160815 | CCTAACTACTTTGTAGGTGAAGA | No data | ||
| Right | 963351811 | 3:144160844-144160866 | CTGTATCCACAGTTAGAATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963351811 | Original CRISPR | CTGTATCCACAGTTAGAATG TGG | Intergenic | ||
| No off target data available for this crispr | |||||