ID: 963353517

View in Genome Browser
Species Human (GRCh38)
Location 3:144181329-144181351
Sequence CTAAATAGACAGAAGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963353517_963353519 -3 Left 963353517 3:144181329-144181351 CCAAGTTCCTTCTGTCTATTTAG No data
Right 963353519 3:144181349-144181371 TAGTTAATATACTTAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963353517 Original CRISPR CTAAATAGACAGAAGGAACT TGG (reversed) Intergenic
No off target data available for this crispr