ID: 963358704

View in Genome Browser
Species Human (GRCh38)
Location 3:144242927-144242949
Sequence ATTGTTCTGGATCTTTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963358704_963358707 -4 Left 963358704 3:144242927-144242949 CCAGAGAAAAGATCCAGAACAAT No data
Right 963358707 3:144242946-144242968 CAATTGTCAAAGGAACACTATGG No data
963358704_963358711 28 Left 963358704 3:144242927-144242949 CCAGAGAAAAGATCCAGAACAAT No data
Right 963358711 3:144242978-144243000 AGAAAAGCAATAGAACAACTTGG No data
963358704_963358710 5 Left 963358704 3:144242927-144242949 CCAGAGAAAAGATCCAGAACAAT No data
Right 963358710 3:144242955-144242977 AAGGAACACTATGGTTGGGAAGG No data
963358704_963358709 1 Left 963358704 3:144242927-144242949 CCAGAGAAAAGATCCAGAACAAT No data
Right 963358709 3:144242951-144242973 GTCAAAGGAACACTATGGTTGGG No data
963358704_963358708 0 Left 963358704 3:144242927-144242949 CCAGAGAAAAGATCCAGAACAAT No data
Right 963358708 3:144242950-144242972 TGTCAAAGGAACACTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963358704 Original CRISPR ATTGTTCTGGATCTTTTCTC TGG (reversed) Intergenic
No off target data available for this crispr