ID: 963359068

View in Genome Browser
Species Human (GRCh38)
Location 3:144247152-144247174
Sequence GTGTCATTCAGGATCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963359056_963359068 25 Left 963359056 3:144247104-144247126 CCCTCCAGTTATTCTACAACTAG No data
Right 963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG No data
963359057_963359068 24 Left 963359057 3:144247105-144247127 CCTCCAGTTATTCTACAACTAGG No data
Right 963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG No data
963359059_963359068 21 Left 963359059 3:144247108-144247130 CCAGTTATTCTACAACTAGGTTG No data
Right 963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963359068 Original CRISPR GTGTCATTCAGGATCTATGT GGG Intergenic
No off target data available for this crispr