ID: 963361117

View in Genome Browser
Species Human (GRCh38)
Location 3:144273034-144273056
Sequence CAGTGTTTCCATAAAGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963361117_963361122 29 Left 963361117 3:144273034-144273056 CCGCCCTCTTTATGGAAACACTG No data
Right 963361122 3:144273086-144273108 AAAGGAAAGAGAATGTGTGTTGG No data
963361117_963361123 30 Left 963361117 3:144273034-144273056 CCGCCCTCTTTATGGAAACACTG No data
Right 963361123 3:144273087-144273109 AAGGAAAGAGAATGTGTGTTGGG No data
963361117_963361121 11 Left 963361117 3:144273034-144273056 CCGCCCTCTTTATGGAAACACTG No data
Right 963361121 3:144273068-144273090 TGAGTTTGTATGAAAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963361117 Original CRISPR CAGTGTTTCCATAAAGAGGG CGG (reversed) Intergenic
No off target data available for this crispr