ID: 963361766

View in Genome Browser
Species Human (GRCh38)
Location 3:144282658-144282680
Sequence GGAGGGGCAGAAAAATGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963361761_963361766 -9 Left 963361761 3:144282644-144282666 CCTCCCCCTTTAAGGGAGGGGCA No data
Right 963361766 3:144282658-144282680 GGAGGGGCAGAAAAATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963361766 Original CRISPR GGAGGGGCAGAAAAATGTCT TGG Intergenic
No off target data available for this crispr