ID: 963361769

View in Genome Browser
Species Human (GRCh38)
Location 3:144282682-144282704
Sequence CCTATAAATAGCCTATCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963361763_963361769 11 Left 963361763 3:144282648-144282670 CCCCTTTAAGGGAGGGGCAGAAA No data
Right 963361769 3:144282682-144282704 CCTATAAATAGCCTATCACTAGG No data
963361761_963361769 15 Left 963361761 3:144282644-144282666 CCTCCCCCTTTAAGGGAGGGGCA No data
Right 963361769 3:144282682-144282704 CCTATAAATAGCCTATCACTAGG No data
963361765_963361769 9 Left 963361765 3:144282650-144282672 CCTTTAAGGGAGGGGCAGAAAAA No data
Right 963361769 3:144282682-144282704 CCTATAAATAGCCTATCACTAGG No data
963361762_963361769 12 Left 963361762 3:144282647-144282669 CCCCCTTTAAGGGAGGGGCAGAA No data
Right 963361769 3:144282682-144282704 CCTATAAATAGCCTATCACTAGG No data
963361764_963361769 10 Left 963361764 3:144282649-144282671 CCCTTTAAGGGAGGGGCAGAAAA No data
Right 963361769 3:144282682-144282704 CCTATAAATAGCCTATCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963361769 Original CRISPR CCTATAAATAGCCTATCACT AGG Intergenic
No off target data available for this crispr