ID: 963367865

View in Genome Browser
Species Human (GRCh38)
Location 3:144362152-144362174
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963367860_963367865 12 Left 963367860 3:144362117-144362139 CCAGTTCATATGTGAGGTGTAAG No data
Right 963367865 3:144362152-144362174 CAGTTCTACCAGCAAGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr