ID: 963375393

View in Genome Browser
Species Human (GRCh38)
Location 3:144457610-144457632
Sequence CCCATGGGGTCCCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963375393_963375400 -3 Left 963375393 3:144457610-144457632 CCAGCCTCAGGGGACCCCATGGG No data
Right 963375400 3:144457630-144457652 GGGGAGCTCTGTAGCTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963375393 Original CRISPR CCCATGGGGTCCCCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr