ID: 963383599

View in Genome Browser
Species Human (GRCh38)
Location 3:144562061-144562083
Sequence CTGTCTCAAGGGCTCGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963383599_963383605 2 Left 963383599 3:144562061-144562083 CCATGCTCGAGCCCTTGAGACAG No data
Right 963383605 3:144562086-144562108 AGAGATGTGGGTGCAGTAAATGG No data
963383599_963383608 27 Left 963383599 3:144562061-144562083 CCATGCTCGAGCCCTTGAGACAG No data
Right 963383608 3:144562111-144562133 AATGCTGAAGGTCTAAGGAATGG No data
963383599_963383606 15 Left 963383599 3:144562061-144562083 CCATGCTCGAGCCCTTGAGACAG No data
Right 963383606 3:144562099-144562121 CAGTAAATGGTGAATGCTGAAGG No data
963383599_963383607 22 Left 963383599 3:144562061-144562083 CCATGCTCGAGCCCTTGAGACAG No data
Right 963383607 3:144562106-144562128 TGGTGAATGCTGAAGGTCTAAGG No data
963383599_963383604 -10 Left 963383599 3:144562061-144562083 CCATGCTCGAGCCCTTGAGACAG No data
Right 963383604 3:144562074-144562096 CTTGAGACAGGCAGAGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963383599 Original CRISPR CTGTCTCAAGGGCTCGAGCA TGG (reversed) Intergenic
No off target data available for this crispr