ID: 963384972

View in Genome Browser
Species Human (GRCh38)
Location 3:144581195-144581217
Sequence GTGCCAGAGGAGGAGCCGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963384966_963384972 17 Left 963384966 3:144581155-144581177 CCGAGAAACATGATGTAATGGTG No data
Right 963384972 3:144581195-144581217 GTGCCAGAGGAGGAGCCGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963384972 Original CRISPR GTGCCAGAGGAGGAGCCGTT GGG Intergenic
No off target data available for this crispr