ID: 963396083

View in Genome Browser
Species Human (GRCh38)
Location 3:144736194-144736216
Sequence TCTTGTTGCTTAGAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963396079_963396083 12 Left 963396079 3:144736159-144736181 CCATCCAAATGACATAAATGATT No data
Right 963396083 3:144736194-144736216 TCTTGTTGCTTAGAGAACTTTGG No data
963396080_963396083 8 Left 963396080 3:144736163-144736185 CCAAATGACATAAATGATTAAAA No data
Right 963396083 3:144736194-144736216 TCTTGTTGCTTAGAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963396083 Original CRISPR TCTTGTTGCTTAGAGAACTT TGG Intergenic
No off target data available for this crispr