ID: 963396084

View in Genome Browser
Species Human (GRCh38)
Location 3:144736197-144736219
Sequence TGTTGCTTAGAGAACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963396080_963396084 11 Left 963396080 3:144736163-144736185 CCAAATGACATAAATGATTAAAA No data
Right 963396084 3:144736197-144736219 TGTTGCTTAGAGAACTTTGGTGG No data
963396079_963396084 15 Left 963396079 3:144736159-144736181 CCATCCAAATGACATAAATGATT No data
Right 963396084 3:144736197-144736219 TGTTGCTTAGAGAACTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963396084 Original CRISPR TGTTGCTTAGAGAACTTTGG TGG Intergenic
No off target data available for this crispr