ID: 963396999

View in Genome Browser
Species Human (GRCh38)
Location 3:144747919-144747941
Sequence AAACCATTTCATGGCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963396999_963397003 19 Left 963396999 3:144747919-144747941 CCCTACTGGCCATGAAATGGTTT No data
Right 963397003 3:144747961-144747983 ACTGTTGTTCTTTAGTGCAAAGG No data
963396999_963397004 20 Left 963396999 3:144747919-144747941 CCCTACTGGCCATGAAATGGTTT No data
Right 963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963396999 Original CRISPR AAACCATTTCATGGCCAGTA GGG (reversed) Intergenic
No off target data available for this crispr