ID: 963397001

View in Genome Browser
Species Human (GRCh38)
Location 3:144747928-144747950
Sequence ATCTTATCTAAACCATTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963397001_963397004 11 Left 963397001 3:144747928-144747950 CCATGAAATGGTTTAGATAAGAT No data
Right 963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG No data
963397001_963397003 10 Left 963397001 3:144747928-144747950 CCATGAAATGGTTTAGATAAGAT No data
Right 963397003 3:144747961-144747983 ACTGTTGTTCTTTAGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963397001 Original CRISPR ATCTTATCTAAACCATTTCA TGG (reversed) Intergenic
No off target data available for this crispr