ID: 963397004

View in Genome Browser
Species Human (GRCh38)
Location 3:144747962-144747984
Sequence CTGTTGTTCTTTAGTGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963397000_963397004 19 Left 963397000 3:144747920-144747942 CCTACTGGCCATGAAATGGTTTA No data
Right 963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG No data
963397001_963397004 11 Left 963397001 3:144747928-144747950 CCATGAAATGGTTTAGATAAGAT No data
Right 963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG No data
963396999_963397004 20 Left 963396999 3:144747919-144747941 CCCTACTGGCCATGAAATGGTTT No data
Right 963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963397004 Original CRISPR CTGTTGTTCTTTAGTGCAAA GGG Intergenic
No off target data available for this crispr