ID: 963398411

View in Genome Browser
Species Human (GRCh38)
Location 3:144763811-144763833
Sequence TTGTATGCCCAGATGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963398411_963398413 -9 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398413 3:144763825-144763847 GGCATACAAGTCCAAAGCTTAGG No data
963398411_963398415 9 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398415 3:144763843-144763865 TTAGGAATTTTCATCAGCGCTGG No data
963398411_963398416 16 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398416 3:144763850-144763872 TTTTCATCAGCGCTGGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963398411 Original CRISPR TTGTATGCCCAGATGGAATA TGG (reversed) Intergenic
No off target data available for this crispr