ID: 963398413

View in Genome Browser
Species Human (GRCh38)
Location 3:144763825-144763847
Sequence GGCATACAAGTCCAAAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963398411_963398413 -9 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398413 3:144763825-144763847 GGCATACAAGTCCAAAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963398413 Original CRISPR GGCATACAAGTCCAAAGCTT AGG Intergenic
No off target data available for this crispr