ID: 963398415

View in Genome Browser
Species Human (GRCh38)
Location 3:144763843-144763865
Sequence TTAGGAATTTTCATCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963398411_963398415 9 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398415 3:144763843-144763865 TTAGGAATTTTCATCAGCGCTGG No data
963398412_963398415 2 Left 963398412 3:144763818-144763840 CCATCTGGGCATACAAGTCCAAA No data
Right 963398415 3:144763843-144763865 TTAGGAATTTTCATCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963398415 Original CRISPR TTAGGAATTTTCATCAGCGC TGG Intergenic
No off target data available for this crispr