ID: 963398416

View in Genome Browser
Species Human (GRCh38)
Location 3:144763850-144763872
Sequence TTTTCATCAGCGCTGGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963398414_963398416 -9 Left 963398414 3:144763836-144763858 CCAAAGCTTAGGAATTTTCATCA No data
Right 963398416 3:144763850-144763872 TTTTCATCAGCGCTGGCTACTGG No data
963398411_963398416 16 Left 963398411 3:144763811-144763833 CCATATTCCATCTGGGCATACAA No data
Right 963398416 3:144763850-144763872 TTTTCATCAGCGCTGGCTACTGG No data
963398412_963398416 9 Left 963398412 3:144763818-144763840 CCATCTGGGCATACAAGTCCAAA No data
Right 963398416 3:144763850-144763872 TTTTCATCAGCGCTGGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963398416 Original CRISPR TTTTCATCAGCGCTGGCTAC TGG Intergenic
No off target data available for this crispr