ID: 963402856

View in Genome Browser
Species Human (GRCh38)
Location 3:144823365-144823387
Sequence TTTTCAAACCAGATAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963402856_963402858 25 Left 963402856 3:144823365-144823387 CCATGTTCTATCTGGTTTGAAAA No data
Right 963402858 3:144823413-144823435 GCCATTTGATCTTTAGCAGTAGG No data
963402856_963402860 26 Left 963402856 3:144823365-144823387 CCATGTTCTATCTGGTTTGAAAA No data
Right 963402860 3:144823414-144823436 CCATTTGATCTTTAGCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963402856 Original CRISPR TTTTCAAACCAGATAGAACA TGG (reversed) Intergenic
No off target data available for this crispr