ID: 963413734

View in Genome Browser
Species Human (GRCh38)
Location 3:144966593-144966615
Sequence ATAATATATATGGCCAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963413730_963413734 25 Left 963413730 3:144966545-144966567 CCACATATATATATACACACACA No data
Right 963413734 3:144966593-144966615 ATAATATATATGGCCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963413734 Original CRISPR ATAATATATATGGCCAAAGA TGG Intergenic
No off target data available for this crispr