ID: 963416429

View in Genome Browser
Species Human (GRCh38)
Location 3:145001014-145001036
Sequence GAGGCTTATGCCCTCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963416420_963416429 15 Left 963416420 3:145000976-145000998 CCTGCAGACTTAACACCATGTGG No data
Right 963416429 3:145001014-145001036 GAGGCTTATGCCCTCTGGAGTGG No data
963416424_963416429 0 Left 963416424 3:145000991-145001013 CCATGTGGAGGCCACCAAGGCTT No data
Right 963416429 3:145001014-145001036 GAGGCTTATGCCCTCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963416429 Original CRISPR GAGGCTTATGCCCTCTGGAG TGG Intergenic
No off target data available for this crispr