ID: 963428863

View in Genome Browser
Species Human (GRCh38)
Location 3:145169943-145169965
Sequence TTTAGCTGTACTGCATAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963428863_963428865 7 Left 963428863 3:145169943-145169965 CCACATTATGCAGTACAGCTAAA No data
Right 963428865 3:145169973-145169995 CTCACTTTTAACTGAATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963428863 Original CRISPR TTTAGCTGTACTGCATAATG TGG (reversed) Intergenic
No off target data available for this crispr