ID: 963433805

View in Genome Browser
Species Human (GRCh38)
Location 3:145242550-145242572
Sequence CAACATGCTGATAGTGATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963433805_963433809 4 Left 963433805 3:145242550-145242572 CCCTTATCACTATCAGCATGTTG No data
Right 963433809 3:145242577-145242599 AAGCCATTCAACAGGTCTCTAGG No data
963433805_963433808 -4 Left 963433805 3:145242550-145242572 CCCTTATCACTATCAGCATGTTG No data
Right 963433808 3:145242569-145242591 GTTGGTCAAAGCCATTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963433805 Original CRISPR CAACATGCTGATAGTGATAA GGG (reversed) Intergenic
No off target data available for this crispr