ID: 963439473

View in Genome Browser
Species Human (GRCh38)
Location 3:145319609-145319631
Sequence ATACGCTGCCTAGAAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963439473_963439474 -10 Left 963439473 3:145319609-145319631 CCAGTTTCTTCTAGGCAGCGTAT No data
Right 963439474 3:145319622-145319644 GGCAGCGTATTTTTGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963439473 Original CRISPR ATACGCTGCCTAGAAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr