ID: 963441853

View in Genome Browser
Species Human (GRCh38)
Location 3:145350072-145350094
Sequence GACTTTCCATGTGTGAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963441853_963441861 20 Left 963441853 3:145350072-145350094 CCTAATCTCACACATGGAAAGTC No data
Right 963441861 3:145350115-145350137 TACAAATTTCTCCTGTCTTTTGG No data
963441853_963441863 22 Left 963441853 3:145350072-145350094 CCTAATCTCACACATGGAAAGTC No data
Right 963441863 3:145350117-145350139 CAAATTTCTCCTGTCTTTTGGGG No data
963441853_963441862 21 Left 963441853 3:145350072-145350094 CCTAATCTCACACATGGAAAGTC No data
Right 963441862 3:145350116-145350138 ACAAATTTCTCCTGTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963441853 Original CRISPR GACTTTCCATGTGTGAGATT AGG (reversed) Intergenic
No off target data available for this crispr