ID: 963441933

View in Genome Browser
Species Human (GRCh38)
Location 3:145351368-145351390
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963441933_963441936 30 Left 963441933 3:145351368-145351390 CCTAGTTTCTGCACAATGCCCAG No data
Right 963441936 3:145351421-145351443 AGATGTATTCATTGAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963441933 Original CRISPR CTGGGCATTGTGCAGAAACT AGG (reversed) Intergenic