ID: 963441936

View in Genome Browser
Species Human (GRCh38)
Location 3:145351421-145351443
Sequence AGATGTATTCATTGAATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963441934_963441936 12 Left 963441934 3:145351386-145351408 CCCAGTTTTTCAGAGTTAATCTG No data
Right 963441936 3:145351421-145351443 AGATGTATTCATTGAATAATAGG No data
963441935_963441936 11 Left 963441935 3:145351387-145351409 CCAGTTTTTCAGAGTTAATCTGT No data
Right 963441936 3:145351421-145351443 AGATGTATTCATTGAATAATAGG No data
963441933_963441936 30 Left 963441933 3:145351368-145351390 CCTAGTTTCTGCACAATGCCCAG No data
Right 963441936 3:145351421-145351443 AGATGTATTCATTGAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963441936 Original CRISPR AGATGTATTCATTGAATAAT AGG Intergenic