ID: 963442112

View in Genome Browser
Species Human (GRCh38)
Location 3:145354231-145354253
Sequence AAGTGAGAAGAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963442105_963442112 27 Left 963442105 3:145354181-145354203 CCAATTGGCTAAACATTTAAACT 0: 4
1: 6
2: 15
3: 36
4: 243
Right 963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963442112 Original CRISPR AAGTGAGAAGAGAGGGAAGA GGG Intergenic
No off target data available for this crispr