ID: 963442547

View in Genome Browser
Species Human (GRCh38)
Location 3:145357516-145357538
Sequence GACGTGTCTCCTCATGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963442539_963442547 12 Left 963442539 3:145357481-145357503 CCTTTACCCCTGAGGCCACTGCA No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data
963442543_963442547 4 Left 963442543 3:145357489-145357511 CCTGAGGCCACTGCAACTAGGCA No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data
963442546_963442547 -3 Left 963442546 3:145357496-145357518 CCACTGCAACTAGGCAGTGGGAC No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data
963442537_963442547 28 Left 963442537 3:145357465-145357487 CCAGGTGGGTCTTGATCCTTTAC No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data
963442542_963442547 5 Left 963442542 3:145357488-145357510 CCCTGAGGCCACTGCAACTAGGC No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data
963442540_963442547 6 Left 963442540 3:145357487-145357509 CCCCTGAGGCCACTGCAACTAGG No data
Right 963442547 3:145357516-145357538 GACGTGTCTCCTCATGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963442547 Original CRISPR GACGTGTCTCCTCATGAGAG AGG Intergenic
No off target data available for this crispr