ID: 963450592

View in Genome Browser
Species Human (GRCh38)
Location 3:145476358-145476380
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963450592_963450595 26 Left 963450592 3:145476358-145476380 CCTGCAGTCTTCTTTTCATTCAC No data
Right 963450595 3:145476407-145476429 ATATATACAGAAATAAATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963450592 Original CRISPR GTGAATGAAAAGAAGACTGC AGG (reversed) Intergenic
No off target data available for this crispr