ID: 963458016

View in Genome Browser
Species Human (GRCh38)
Location 3:145572066-145572088
Sequence TGGAGTATAAGAAGCATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963458016_963458020 23 Left 963458016 3:145572066-145572088 CCTATCATGCTTCTTATACTCCA No data
Right 963458020 3:145572112-145572134 AGAAATAGCCTTTTGCCTGGAGG No data
963458016_963458018 -1 Left 963458016 3:145572066-145572088 CCTATCATGCTTCTTATACTCCA No data
Right 963458018 3:145572088-145572110 ACAGCTAAAGTGATAACTTCTGG No data
963458016_963458019 20 Left 963458016 3:145572066-145572088 CCTATCATGCTTCTTATACTCCA No data
Right 963458019 3:145572109-145572131 GGCAGAAATAGCCTTTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963458016 Original CRISPR TGGAGTATAAGAAGCATGAT AGG (reversed) Intergenic
No off target data available for this crispr