ID: 963458499

View in Genome Browser
Species Human (GRCh38)
Location 3:145577107-145577129
Sequence AACCTGGATAGCCCTACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963458499_963458501 0 Left 963458499 3:145577107-145577129 CCTGATGTAGGGCTATCCAGGTT No data
Right 963458501 3:145577130-145577152 AAAGTTATTCATTAAAGATTTGG No data
963458499_963458502 14 Left 963458499 3:145577107-145577129 CCTGATGTAGGGCTATCCAGGTT No data
Right 963458502 3:145577144-145577166 AAGATTTGGATAGCTTTCACAGG No data
963458499_963458503 24 Left 963458499 3:145577107-145577129 CCTGATGTAGGGCTATCCAGGTT No data
Right 963458503 3:145577154-145577176 TAGCTTTCACAGGAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963458499 Original CRISPR AACCTGGATAGCCCTACATC AGG (reversed) Intergenic
No off target data available for this crispr