ID: 963458855

View in Genome Browser
Species Human (GRCh38)
Location 3:145579814-145579836
Sequence TACCATGAGCAGGGCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963458855_963458859 21 Left 963458855 3:145579814-145579836 CCTCTCCTGCCCTGCTCATGGTA No data
Right 963458859 3:145579858-145579880 ACAAGACAAAAAAATACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963458855 Original CRISPR TACCATGAGCAGGGCAGGAG AGG (reversed) Intergenic
No off target data available for this crispr