ID: 963470827

View in Genome Browser
Species Human (GRCh38)
Location 3:145739832-145739854
Sequence CTGAAATTCTGAAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963470824_963470827 -4 Left 963470824 3:145739813-145739835 CCATAAATATCAATGATATCTGA No data
Right 963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963470827 Original CRISPR CTGAAATTCTGAAGGGAAGA AGG Intergenic
No off target data available for this crispr