ID: 963471759

View in Genome Browser
Species Human (GRCh38)
Location 3:145750096-145750118
Sequence CTGGACAAAAGGTTTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963471759_963471763 -4 Left 963471759 3:145750096-145750118 CCAACAAAAAACCTTTTGTCCAG No data
Right 963471763 3:145750115-145750137 CCAGCTATTGGAATGTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963471759 Original CRISPR CTGGACAAAAGGTTTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr