ID: 963482940

View in Genome Browser
Species Human (GRCh38)
Location 3:145899950-145899972
Sequence TCTCAAATTCTGAGGTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963482938_963482940 -7 Left 963482938 3:145899934-145899956 CCTACAGGATATTTTCTCTCAAA No data
Right 963482940 3:145899950-145899972 TCTCAAATTCTGAGGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963482940 Original CRISPR TCTCAAATTCTGAGGTTAGT TGG Intergenic
No off target data available for this crispr