ID: 963490371

View in Genome Browser
Species Human (GRCh38)
Location 3:145992819-145992841
Sequence TCTCCTTCTGTCTGGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963490371_963490375 21 Left 963490371 3:145992819-145992841 CCAATGTCCCAGACAGAAGGAGA No data
Right 963490375 3:145992863-145992885 TTGTTTTATTCAGGCCTTGATGG No data
963490371_963490374 12 Left 963490371 3:145992819-145992841 CCAATGTCCCAGACAGAAGGAGA No data
Right 963490374 3:145992854-145992876 AGTTAGTCTTTGTTTTATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963490371 Original CRISPR TCTCCTTCTGTCTGGGACAT TGG (reversed) Intergenic
No off target data available for this crispr