ID: 963492266 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:146016733-146016755 |
| Sequence | CGCAAAACAGCAGTGGTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963492266_963492274 | 20 | Left | 963492266 | 3:146016733-146016755 | CCCTCCACCACTGCTGTTTTGCG | No data | ||
| Right | 963492274 | 3:146016776-146016798 | GACTTCCATTCTTCCGCATCCGG | No data | ||||
| 963492266_963492275 | 24 | Left | 963492266 | 3:146016733-146016755 | CCCTCCACCACTGCTGTTTTGCG | No data | ||
| Right | 963492275 | 3:146016780-146016802 | TCCATTCTTCCGCATCCGGCAGG | No data | ||||
| 963492266_963492277 | 25 | Left | 963492266 | 3:146016733-146016755 | CCCTCCACCACTGCTGTTTTGCG | No data | ||
| Right | 963492277 | 3:146016781-146016803 | CCATTCTTCCGCATCCGGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963492266 | Original CRISPR | CGCAAAACAGCAGTGGTGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||