ID: 963492266

View in Genome Browser
Species Human (GRCh38)
Location 3:146016733-146016755
Sequence CGCAAAACAGCAGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963492266_963492274 20 Left 963492266 3:146016733-146016755 CCCTCCACCACTGCTGTTTTGCG No data
Right 963492274 3:146016776-146016798 GACTTCCATTCTTCCGCATCCGG No data
963492266_963492275 24 Left 963492266 3:146016733-146016755 CCCTCCACCACTGCTGTTTTGCG No data
Right 963492275 3:146016780-146016802 TCCATTCTTCCGCATCCGGCAGG No data
963492266_963492277 25 Left 963492266 3:146016733-146016755 CCCTCCACCACTGCTGTTTTGCG No data
Right 963492277 3:146016781-146016803 CCATTCTTCCGCATCCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963492266 Original CRISPR CGCAAAACAGCAGTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr