ID: 963496853

View in Genome Browser
Species Human (GRCh38)
Location 3:146075147-146075169
Sequence CTGTGAAAGAGGAAGGTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 342}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963496850_963496853 -4 Left 963496850 3:146075128-146075150 CCTCTTTTCAGCTTTATTTCTGT 0: 1
1: 0
2: 2
3: 68
4: 734
Right 963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG 0: 1
1: 0
2: 3
3: 40
4: 342
963496848_963496853 15 Left 963496848 3:146075109-146075131 CCCTCACGACTAGAAAACACCTC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG 0: 1
1: 0
2: 3
3: 40
4: 342
963496849_963496853 14 Left 963496849 3:146075110-146075132 CCTCACGACTAGAAAACACCTCT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG 0: 1
1: 0
2: 3
3: 40
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963496853 Original CRISPR CTGTGAAAGAGGAAGGTATG TGG Intronic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902973442 1:20071738-20071760 CCGTGAAGGAGCAAGCTATGGGG - Intronic
903866050 1:26398685-26398707 CTCTAAAAGAAGAAAGTATGGGG + Intergenic
904439559 1:30521563-30521585 CTGTGAACCAGGCAGGGATGGGG - Intergenic
904894053 1:33800806-33800828 CTGTAAAAGGGAAAGGAATGAGG + Intronic
905588967 1:39145353-39145375 CTCTGAAATAGGAGGGAATGTGG - Intronic
906125711 1:43425895-43425917 CTGTGTCAGAGCAAGGAATGGGG + Exonic
906680445 1:47722611-47722633 CTGTGGAAGAGGAAGATTTCAGG + Intergenic
907109194 1:51911083-51911105 CTGAGAAATAGGAACGGATGTGG + Exonic
908216604 1:61960326-61960348 TTGTGTAATAGGAAGATATGAGG - Intronic
908702416 1:66916553-66916575 TTGTGAAAGAGGTTGGAATGTGG + Intronic
908823565 1:68112898-68112920 CTGTTAAAGAGCAAGGAATTTGG + Intronic
911063413 1:93766628-93766650 CTAAGAAAGAGGAAGGCATCAGG - Intronic
912707505 1:111925891-111925913 CTGGGAAAGAGGATGGTGTCGGG - Intronic
915426821 1:155834122-155834144 CAGTTAAAGAGGAAGGAATGGGG - Intronic
915580454 1:156809811-156809833 CTGGGAAAGAAGGAGGTCTGAGG + Intronic
915940753 1:160116756-160116778 CTGCGGAACAGGAGGGTATGAGG + Intronic
916076169 1:161201089-161201111 CAGGGAAAGAGCAAGGAATGAGG + Intronic
917253416 1:173088071-173088093 AAGTGAAAGAAGAAGGGATGTGG + Intergenic
917322462 1:173797568-173797590 ATGTGAAAGAGCAATGTATGTGG - Intergenic
917622909 1:176816000-176816022 TTGTGAGGGAGGAAGGTATGTGG + Intronic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917952435 1:180053820-180053842 ATATGAAAGAGGAAGAAATGAGG + Exonic
918163852 1:181925707-181925729 CAGTGAAAAAGAAAGGTTTGAGG - Intergenic
921408526 1:214809241-214809263 ATGAGAAAGTGGAAGGCATGAGG + Intergenic
922897461 1:229111500-229111522 CTCTGAGAGAGGCAGGTCTGGGG + Intergenic
922982729 1:229841488-229841510 CTGCGAAAGAAGAACGTGTGAGG - Intergenic
923398067 1:233587289-233587311 CCCGGAAAGTGGAAGGTATGGGG + Intergenic
924354058 1:243151132-243151154 CTGTGAAACAGGAAGCCGTGAGG - Intronic
1063338979 10:5245050-5245072 CAGTGACAGCGGAAGGTAAGGGG - Intergenic
1063344119 10:5295317-5295339 CAGTGACAGCGGAAGGTAAGGGG + Intergenic
1063759093 10:9051871-9051893 CTGTGAGAGAGAAAGCCATGGGG - Intergenic
1063869328 10:10401151-10401173 ATGTGAAAGTTCAAGGTATGTGG - Intergenic
1065527561 10:26638329-26638351 CAGGGAAAGAGGAAGGGGTGGGG - Intergenic
1069119742 10:64555295-64555317 CTGTGAAAGAGAAAGAAATTGGG - Intergenic
1069290883 10:66778335-66778357 CTTTGAAAAAAGAAGGAATGAGG - Intronic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1071111338 10:82161069-82161091 CTGGGAAAGAACAAGGTATAGGG + Intronic
1071152980 10:82657130-82657152 GAGTGAAAGAGCAAAGTATGAGG - Intronic
1073058958 10:100721881-100721903 CTGTGGAAGGTGCAGGTATGGGG - Intergenic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1075007105 10:118839107-118839129 CTGGGGAGGAGGAAGGGATGGGG + Intergenic
1075841755 10:125510596-125510618 CAGTCAAAGAGGAAGGTAAAAGG - Intergenic
1076432211 10:130412210-130412232 CTCTGGAAGACAAAGGTATGAGG - Intergenic
1076785339 10:132746934-132746956 CTGTGAATGAGGCAGCTCTGGGG + Intronic
1077473152 11:2774283-2774305 CTGTGATAGAGGCAGGCATGGGG - Intronic
1077756378 11:5033236-5033258 CTGTAAAATAGGAAGATAGGAGG + Intergenic
1078002826 11:7511903-7511925 CTGTGAAATAGGTAGGTAATAGG - Intergenic
1079374868 11:19882835-19882857 CTGGGCAAGATGAAGGGATGAGG - Intronic
1079998025 11:27317247-27317269 CTTTGAAAAAGGAAGAAATGAGG + Intergenic
1081632698 11:44700628-44700650 CTCTGTAAGAGGATGGTAGGAGG + Intergenic
1081887751 11:46513723-46513745 CTGACAAACAGGAAGGTCTGTGG + Intronic
1084221794 11:67685819-67685841 CTGGGAAAGGGGAAGAGATGAGG + Intergenic
1084323934 11:68388328-68388350 CTGTGAAAAAGGAAGGGATGGGG + Intronic
1085673145 11:78488339-78488361 ACGTGAAAGAGGGAGGCATGAGG + Intronic
1085854485 11:80160796-80160818 ATGTGATAGAGCAAAGTATGAGG + Intergenic
1085897312 11:80655530-80655552 CTGTGAAATAAGAAGGTCTAAGG + Intergenic
1086815597 11:91366776-91366798 CAGTGACAGAGAAAGGAATGTGG - Intergenic
1088767613 11:112999045-112999067 CTCTGAAGGAGGTAGGTGTGTGG - Intronic
1089784594 11:120898904-120898926 CTGTGCAGGAGGAAGGGAAGGGG + Intronic
1091112762 11:132985519-132985541 CTTTGAAAGAGAGAGGTGTGAGG - Intronic
1091585352 12:1812855-1812877 CTGTGAAACGGGAACGGATGTGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091748722 12:3009771-3009793 CTGTGTCAGAGGAAGGAGTGGGG - Intronic
1092654168 12:10667369-10667391 CTTTGGAAGATGAAGGCATGAGG + Intronic
1093245098 12:16726616-16726638 CTATGAAGGAGGCAGATATGGGG + Intergenic
1095746114 12:45660745-45660767 CTGTGAAAGACAAAGGGAAGAGG - Intergenic
1096212951 12:49780333-49780355 CAGTAAAAGAGGGAGGCATGGGG - Intergenic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1096520482 12:52182010-52182032 GTGGGAAAGAAGAAGGCATGAGG - Intronic
1097907615 12:64936558-64936580 TTCTGAAAGAGAAAGGTAAGAGG + Intergenic
1098305972 12:69103018-69103040 AAGTGAAAGAGGAAGTCATGTGG + Intergenic
1098351104 12:69561694-69561716 TTGTGGAATAGGAAGATATGGGG + Intronic
1098778890 12:74658579-74658601 CTAGAAAAGAGTAAGGTATGAGG + Intergenic
1100531636 12:95466882-95466904 CTGTAAAAGAAAAAGATATGTGG + Intergenic
1100687716 12:97004636-97004658 CTGAGAAGGAGCAAGGTTTGGGG + Intergenic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1103088096 12:118077497-118077519 CTGTGAAAGAGGAATGTTTGTGG + Intronic
1103151549 12:118643971-118643993 CTGAGAAAGAGAAGGGTAAGGGG - Intergenic
1104694307 12:130852011-130852033 CTGGGAAACAGGAAGTTATTGGG - Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1106753354 13:32797039-32797061 CTGGGTAAGAGGAAGGCCTGGGG + Intergenic
1107611259 13:42115513-42115535 CTTTGAAGGAGGATGGGATGGGG + Intronic
1108138657 13:47393925-47393947 GAGTGAAAGGGGAAAGTATGTGG + Intergenic
1108626049 13:52229780-52229802 CTGAGTTAGAGGAAGGTGTGTGG + Intergenic
1108660014 13:52576699-52576721 CTGAGTTAGAGGAAGGTGTGTGG - Intergenic
1109792523 13:67268385-67268407 GGGAGAAAGAGGAAGGTATTAGG + Intergenic
1109808607 13:67476979-67477001 TTGTGAAAGAGGAATGAATTTGG + Intergenic
1110406012 13:75151354-75151376 CTGGTAAAGAGGGAGGGATGGGG + Intergenic
1110597682 13:77337171-77337193 CTGTAAAAGAGGTAGGTGAGTGG + Intergenic
1110661257 13:78061230-78061252 CTGTGAAAGAGAAAGCCTTGTGG + Intergenic
1111106344 13:83650324-83650346 CTGTGAAAGAAGAATGTTTCAGG + Intergenic
1111119978 13:83834092-83834114 CTATGAAACAGGTAGGTATTTGG + Intergenic
1111473450 13:88717290-88717312 TTATTACAGAGGAAGGTATGAGG + Intergenic
1111673606 13:91359373-91359395 AAGTGAAAGAGGGAGGTAAGAGG - Intergenic
1112862546 13:103850492-103850514 CTGTAAACGAGGCAGGTATTTGG - Intergenic
1112926076 13:104677138-104677160 CTGGGGAAGAGGAATATATGGGG - Intergenic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113112066 13:106834066-106834088 CTGTGAAACAGGAATTTATGAGG + Intergenic
1113794064 13:113046574-113046596 TTGTAAAAGATGAAGGAATGAGG - Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1116115890 14:40650211-40650233 TTGTGGAATAGGAAGATATGGGG + Intergenic
1117848270 14:59937015-59937037 CTGGTAATGAGAAAGGTATGAGG + Intronic
1117910352 14:60631886-60631908 GTGTGAAAGAGGAAGATATAGGG + Intergenic
1118341626 14:64898551-64898573 CTGGGAAAGTGGAAAGCATGAGG + Intergenic
1119075970 14:71639623-71639645 CTGAGAAAGAGGAATTAATGTGG + Intronic
1120042257 14:79767463-79767485 CTGTAAAAGAGAAATGCATGAGG - Intronic
1121060873 14:90908470-90908492 CTGTGAAAACAGAAGATATGTGG + Intronic
1121566407 14:94913260-94913282 GTGGGAAAGAAGAAGGAATGAGG + Intergenic
1122405656 14:101499287-101499309 CTGGGAAAGAGGCAGGTCTGCGG - Intergenic
1122955787 14:105070346-105070368 CTGAGAAAGAGGAAACTCTGTGG - Intergenic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1124103449 15:26716699-26716721 CTGTGAAAGAGAAAGGCAGTTGG - Intronic
1125750774 15:42026583-42026605 CTGTGGAAGAGGAGGCTATCAGG + Intronic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1126341250 15:47643386-47643408 GTTTGAAAGAGGAAGGGGTGAGG + Intronic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1128670319 15:69569925-69569947 TTGAGAAACAGGAAGGTAGGAGG - Intergenic
1128812268 15:70581189-70581211 CTGTGACAGAGGAGGGACTGGGG - Intergenic
1133652883 16:7829601-7829623 CTTTAAAAGAGGAAGGTGGGTGG - Intergenic
1134540889 16:15064497-15064519 CTGTGCAACAGAATGGTATGTGG + Intronic
1135180668 16:20271357-20271379 CTGAGAGAGAGGCAGGTAAGAGG + Intergenic
1137022880 16:35447690-35447712 CTCTGTAAATGGAAGGTATGTGG - Intergenic
1137894296 16:52194568-52194590 TTTTGAATGAGGCAGGTATGAGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1140999426 16:80294760-80294782 CTTTGTAAGAGGAAGGCAGGAGG - Intergenic
1141066198 16:80916010-80916032 GTGGGCAAGAGGAAGGAATGGGG - Intergenic
1141191065 16:81824925-81824947 CTTTAAAAGAGGAAGGTAGGAGG + Intronic
1141514950 16:84537656-84537678 CTGTGAAAAAGGCTGGTGTGGGG + Intronic
1142045644 16:87923514-87923536 CCTAGAAGGAGGAAGGTATGTGG - Intronic
1143451739 17:7040840-7040862 ATGGGGAAGAGGGAGGTATGTGG - Intergenic
1144105349 17:11979658-11979680 ATGTGAAAGAGAAAGGTAAATGG - Intronic
1144209731 17:13003918-13003940 CTGTGAGAGAGGAAGGAGAGAGG - Intronic
1144510671 17:15872438-15872460 CTGTGAAAAATGATGGTATTTGG + Intergenic
1145174827 17:20690161-20690183 CTGTGAAAAATGATGGTATTTGG + Intergenic
1145289644 17:21533122-21533144 ATATGAAAGAGAAAGGTGTGGGG + Exonic
1146016144 17:29235349-29235371 CTACGAAAGAGGAAGATATAGGG + Intergenic
1146514594 17:33479621-33479643 TTGTGAATGTGGAAGGTATTTGG - Intronic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1147261182 17:39210495-39210517 CTGGGACAGAGGAAGGAAAGGGG - Intergenic
1147310326 17:39592263-39592285 CTGGGAAAGGGGATGGGATGGGG - Intergenic
1148061977 17:44842920-44842942 GTGTTAAAGGGGAAGGGATGGGG - Intergenic
1148565487 17:48630669-48630691 CTGGGAAAGAGTGAGGCATGAGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152054579 17:78013841-78013863 CTATGAAATAGCAGGGTATGAGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1153859092 18:9181678-9181700 ATGTTAAAGAGGAACCTATGAGG - Intronic
1154193756 18:12251533-12251555 CTGTGACAGATGAAGATCTGAGG + Intergenic
1155323119 18:24638368-24638390 CTGAGAGACAGGAAGGTAGGAGG + Intergenic
1155865634 18:30961201-30961223 CAGTGAAAGAGGATGGTTTCAGG - Intergenic
1156810381 18:41242089-41242111 GTGTGATAGAGGAAAGTGTGAGG - Intergenic
1157027512 18:43863364-43863386 CTGTGAAACTGGAAGCTATTTGG - Intergenic
1157381359 18:47221287-47221309 CTGTAATAGAGGGAAGTATGTGG + Intronic
1157960953 18:52152716-52152738 CACTGAAATAGGAAGGTAAGGGG + Intergenic
1159870958 18:73759386-73759408 CTCTGTAAGAAGAAGGCATGAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1163739229 19:19000390-19000412 CAGTGAAAGAGAAATGGATGAGG - Intronic
1164610419 19:29627943-29627965 CTGTGACAGAGGGAGGGCTGGGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165930679 19:39356585-39356607 CCCTGAAAGAGAAAGGCATGAGG + Intronic
1166058805 19:40311600-40311622 CTGTGAAAGCGCAAGGTGTGGGG - Intergenic
1166273306 19:41732472-41732494 AAGTGAAAGAGGAAGGCAGGAGG - Intronic
1166278376 19:41772297-41772319 AAGTGAAAGAGGAAGGCAGGAGG - Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1166489949 19:43250091-43250113 GAGTGAAAGAGGAAGGCAGGAGG + Intronic
1166576106 19:43839949-43839971 CAGTGAAACAGGAAAATATGGGG - Intronic
1166992950 19:46704246-46704268 CTGTGGATGAGGAAGGTGTGCGG + Exonic
1167263357 19:48471012-48471034 CCGTGACGGAGGAAGGTATCAGG + Intronic
1168695074 19:58399697-58399719 AAGTGAAAGAGGGAGGTAGGAGG - Intergenic
925068239 2:946809-946831 GTGTGAAACAGGAAGGTAATAGG + Intergenic
925372923 2:3360892-3360914 CTCAGGAAGAGGAAAGTATGGGG + Intronic
926388059 2:12357974-12357996 ATGTGAAAGAAGGAGGGATGGGG + Intergenic
926464726 2:13174366-13174388 GTGGGAAAGAGGAAGGAATGAGG - Intergenic
926728399 2:16015586-16015608 AGGTGAAACAGGATGGTATGGGG + Intergenic
926965036 2:18400566-18400588 CTGACAAGGAGCAAGGTATGGGG + Intergenic
927031776 2:19127759-19127781 CAGAGAAAGAGGCAGGTGTGAGG + Intergenic
928588749 2:32791371-32791393 ATGTGGAAGAGGAAGGAAAGGGG + Intronic
928618324 2:33061837-33061859 CTGTGTATAAGGTAGGTATGTGG + Intronic
928744393 2:34394587-34394609 TTAGGAAAGAGGAAGGTAGGAGG - Intergenic
929162168 2:38843211-38843233 CTGAGAAAGACAAAGGAATGTGG + Intronic
929804267 2:45130917-45130939 AGGTTAAAGAGGAAGCTATGAGG + Intergenic
932127109 2:69154612-69154634 GAGTGACAGAGGAAGGTTTGAGG - Intronic
932294786 2:70615339-70615361 TTGTGTAAGAGGAAGGTGTCTGG + Intronic
932606796 2:73170654-73170676 GTGTGACAGAGGAAGGGAGGGGG + Intergenic
932634613 2:73377571-73377593 CTGTGAAAGATGAAGCTCAGGGG - Intergenic
933643153 2:84785912-84785934 CTGTGAAATACGAAGGCAAGGGG - Intronic
933787346 2:85854078-85854100 TAGAGAAAGAGGAAGGAATGGGG - Intronic
933925632 2:87089756-87089778 GTGTGACAGAGGAAGGGAGGGGG - Intergenic
934039372 2:88115358-88115380 CAGTAAAAGAGGAAGGCAGGAGG - Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
935524464 2:104148444-104148466 GTGGGAAAGATGAAGGAATGAGG - Intergenic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936534096 2:113298090-113298112 CTGTGGGAAAGGAAGGAATGGGG - Intergenic
936675465 2:114709054-114709076 CAGTGAAAGAGTAAGCAATGGGG - Intronic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937160982 2:119760370-119760392 CTGTGATATACGAAGGTAAGAGG + Exonic
937257645 2:120566300-120566322 CCCTGGAAGAGGAAGGCATGGGG - Intergenic
937367377 2:121273398-121273420 CTGACAAAGAGGAAGTTATCTGG + Intronic
937493654 2:122395511-122395533 CAGTGACAGAGGCAGGTCTGTGG + Intergenic
937990929 2:127661941-127661963 CTGGGATGGAGGAAGGTCTGGGG - Intronic
938225188 2:129609732-129609754 TTGAAAAAGAGGAAGGGATGGGG + Intergenic
938652148 2:133394436-133394458 CATTGAAAGAGGCAGGTGTGGGG + Intronic
940218913 2:151330440-151330462 CTTTGAAAGTGGAAATTATGAGG + Intergenic
940847422 2:158656847-158656869 CTGTAAAAGAGGGTGGTATGGGG - Intronic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
941159189 2:162016540-162016562 CTGTCAAAAAGGAAGGGATTTGG - Intronic
941185189 2:162313965-162313987 CTGTGTAAATGGAAGGTGTGTGG + Intronic
942124960 2:172814796-172814818 CTGGGAAAGTGGAATGAATGGGG + Intronic
942535031 2:176954333-176954355 GTGAGAGAGAGGAAGGAATGTGG + Intergenic
942650999 2:178167782-178167804 CTGTTAATGAGCAAGGTATTTGG + Intergenic
942858549 2:180582234-180582256 CTGTTAAAGATGGAGTTATGTGG + Intergenic
943538164 2:189178990-189179012 TTGTTAAAGAGGAAAGAATGAGG + Intronic
944298319 2:198092690-198092712 ATGTGACAAAGGAATGTATGGGG - Intronic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
945224389 2:207518429-207518451 CGGTGAAAGGTGAATGTATGTGG - Intergenic
945232598 2:207608213-207608235 CTGGGAAAGAGGAAGAAATTGGG - Intronic
948165695 2:235860448-235860470 ATGTGAGACTGGAAGGTATGGGG - Intronic
1172015148 20:31869083-31869105 CTGACAAGGAGGAAGTTATGGGG + Intronic
1172298233 20:33829188-33829210 CTGGGAGAGAGGAGGGTGTGTGG + Intronic
1173264804 20:41469396-41469418 CAATGGAAGAGGAAGGTTTGTGG + Intronic
1174180629 20:48672188-48672210 CTATGAAAGAGGCAGGTGTGCGG - Intronic
1175445534 20:59017255-59017277 CTGCTATAGAGGATGGTATGAGG - Intergenic
1176340984 21:5695829-5695851 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
1176473238 21:7127982-7128004 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
1176503843 21:7628627-7628649 CTGGGAAAGAAGAAGGGATGTGG + Intergenic
1177452298 21:21286089-21286111 CAGTGAGATAGGAAGGTATTAGG + Intronic
1178072365 21:28982744-28982766 CCATCACAGAGGAAGGTATGAGG + Intronic
1179793087 21:43766864-43766886 CTGTGAAAGGGGAGGGCCTGGGG + Intergenic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1182240115 22:28909572-28909594 TTATGAATGAGGAAAGTATGTGG - Intronic
1182286648 22:29252538-29252560 CTAGGAAAGAGGAAGGAGTGAGG + Intronic
1182415173 22:30216798-30216820 GTGTGAAGGAGGAGGGTGTGAGG + Intergenic
1182734921 22:32526375-32526397 CTGTGGAAGAGGAAGCCATTTGG + Intronic
1185233547 22:49698294-49698316 ATGTGAAAGAGGAATATAAGTGG + Intergenic
1203240250 22_KI270733v1_random:10287-10309 CTGGGAAAGAAGAAGGGATGTGG - Intergenic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
950282873 3:11721658-11721680 CAGGGAATGAGGAAGGAATGAGG + Intergenic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950579857 3:13855030-13855052 CAGTAAAGGAGGAAGGTATGTGG + Intronic
950756025 3:15173392-15173414 CAGTGTAAGAGGAAGGTCTGGGG - Intergenic
951359700 3:21710950-21710972 CTATGATAGAGGAAGGAATGGGG - Intronic
952561323 3:34596854-34596876 GTGTGTATGAGGAGGGTATGGGG + Intergenic
952980710 3:38733026-38733048 TTGTGCAAGAGAAAGGCATGGGG + Intronic
953227558 3:41034365-41034387 CTGTGAAAGATAAAGGTAGAGGG - Intergenic
953708776 3:45251989-45252011 TTCTAAAAGAGGAAGGAATGAGG + Intergenic
953891445 3:46754422-46754444 CTGGGAATGAGGAAGCTTTGAGG + Intronic
956335293 3:68156293-68156315 CTGGGAAATAAGAAGGAATGAGG + Intronic
956783423 3:72622846-72622868 CAGTGAAAGAGAAAGGAAAGGGG - Intergenic
956849967 3:73219976-73219998 CTGGGTAAGAGGAAGGGCTGAGG + Intergenic
958727591 3:97924709-97924731 CCCTGTAAGAGGAAGGTAGGAGG - Intronic
960855330 3:122096792-122096814 CTGTGAAACAGAAAGCTATAGGG - Intronic
960861201 3:122154970-122154992 CTGTTACACAGGAAGGTATCTGG + Intergenic
960883328 3:122368511-122368533 CTCTGAGGGTGGAAGGTATGAGG + Intronic
961699856 3:128734597-128734619 CTGTGAAAGAGTAATCTGTGGGG + Intronic
961744281 3:129053874-129053896 CTTTGAAAGAGGAGGGGTTGGGG + Intergenic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
962708426 3:138066803-138066825 CTGTGAGAGAGGGTAGTATGTGG - Intronic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
964061176 3:152525741-152525763 CAGTGAAAGAGGAAATTTTGAGG + Intergenic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
965086212 3:164101809-164101831 CAGTGAAGGAGGAAAGGATGGGG - Intergenic
965246396 3:166276663-166276685 ATGAGTAAGAGGAAGGTAAGAGG + Intergenic
965309539 3:167112309-167112331 GTGGGAAAGAGGATGGTAGGTGG + Intergenic
965403054 3:168236525-168236547 ATGTGAATGAGGAAGCTCTGGGG - Intergenic
967094690 3:186167490-186167512 CTGTGATAGAGGAAGTAAAGGGG - Intronic
967371432 3:188750708-188750730 TTGTGAAACAAGAAGGTAAGAGG + Intronic
968783253 4:2599252-2599274 CTTTGACAGAGGAAGGAAAGTGG - Intronic
968961275 4:3744970-3744992 CTTTGAAAGAGAAACGCATGGGG - Intergenic
970023658 4:11597031-11597053 GTCTGAAAGAGGAAGGGAGGGGG - Intergenic
970373908 4:15436757-15436779 CTCTAAAAGAGGAAGGGATTTGG + Intronic
971539947 4:27803426-27803448 CTCCCAAAGAGTAAGGTATGGGG - Intergenic
973963922 4:56141039-56141061 CAGTGAAAGAGGAGGGCTTGTGG + Intergenic
975980753 4:80156613-80156635 CTGTGAAATAGGAAAGCATTAGG - Intergenic
977055607 4:92186848-92186870 CTGTGAAAGAAGAAGGTTTCAGG + Intergenic
977516665 4:98028921-98028943 AGGTGAAAGAGGAAATTATGAGG - Intronic
979089874 4:116469037-116469059 CCCTGAAAAAGGAAGGTAGGTGG - Intergenic
980931803 4:139189191-139189213 GTGGGAAAGAGGAAGGTCTTAGG + Intergenic
981331918 4:143519971-143519993 CTCTGAAACAGGAAGAAATGAGG - Intronic
981562604 4:146063982-146064004 CTGTGAAAGGTAAAGGGATGAGG - Intergenic
981972866 4:150686746-150686768 CTGTTTAATATGAAGGTATGTGG - Intronic
982335377 4:154231280-154231302 AAGTGAAAGAGGAAGGGAGGGGG - Intergenic
983154254 4:164326754-164326776 CTGTGAATAAGTAAGGTTTGTGG - Intronic
983400008 4:167250776-167250798 CTGAGAAAGAGGATGGTGTCAGG - Intergenic
984371996 4:178880078-178880100 ATGTGAAAGTGGAAGGGGTGAGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
987361894 5:17114946-17114968 CTGGGAAAGAGGAACCTGTGTGG - Intronic
987441476 5:17961988-17962010 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
987441586 5:17963339-17963361 CTATGTAGGAGGAAGGTTTGGGG + Intergenic
987525870 5:19048582-19048604 CTGGGAAAGACGATGCTATGAGG - Intergenic
987799880 5:22680882-22680904 CAGTGAAGGAGTAAGGTATTTGG - Intronic
988057585 5:26119680-26119702 CTGTGAATGAGGAAGACACGGGG + Intergenic
988949697 5:36243489-36243511 CTGTGAAATGGGAAGAAATGAGG - Intergenic
990637755 5:57748529-57748551 TTGAGATAGAGGAAGGTGTGGGG + Intergenic
990833512 5:59987436-59987458 CTGTGTTAGAAAAAGGTATGAGG - Intronic
991071727 5:62490546-62490568 CTGTGAAAGATGAATGTCTTGGG + Intronic
993432486 5:87848944-87848966 CAGTGAAAGAGAAACTTATGGGG - Intergenic
994687114 5:102969330-102969352 CTGTGGAAAAGGTAGCTATGGGG + Intronic
996636375 5:125694034-125694056 CTGTGAAGGAGGAAAGAATATGG - Intergenic
996905953 5:128600109-128600131 GTGTCAAAAAGGAAGGAATGCGG - Intronic
999582488 5:153054898-153054920 CTGTGAACAAAGAAGGTATTTGG - Intergenic
1000596420 5:163219748-163219770 CTGTGAAAGAGGAAGCTGCTGGG + Intergenic
1000622172 5:163498328-163498350 CTGTGAGAGAGGAAAACATGAGG + Intergenic
1001887574 5:175309284-175309306 CAGTGAAAGGGCAAGGTATCTGG - Intergenic
1003986007 6:11436030-11436052 CTGTGCCCTAGGAAGGTATGTGG + Intergenic
1004012366 6:11702101-11702123 CTGTGAAGGATGAAGGGTTGAGG - Intergenic
1007045478 6:38769453-38769475 TTGTGATAGAGGAAAGAATGAGG + Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1008837008 6:55845851-55845873 CTTTTATAGAGGAAGGTATTTGG + Intronic
1012267497 6:97163837-97163859 CTGTGACATAGGGAGGTATGAGG + Intronic
1012530963 6:100235888-100235910 TTGTTGAAGAGGAATGTATGAGG - Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1014028137 6:116672257-116672279 CAAAGAAAGTGGAAGGTATGGGG + Intergenic
1014028330 6:116673876-116673898 CAAAGAAAGTGGAAGGTATGGGG + Intergenic
1014076085 6:117236031-117236053 ATGTGAAAGCGGCTGGTATGGGG + Intergenic
1014887972 6:126805226-126805248 CTGTGCAAGATGAACTTATGTGG - Intergenic
1015574399 6:134655932-134655954 CTGTAAAATAGGGAGGTTTGTGG + Intergenic
1016844039 6:148553710-148553732 CTGTGAGAGAGAAAGGGAGGAGG + Intergenic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1017086296 6:150716138-150716160 CTTTGAAAGAACAAGGCATGCGG - Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1018973105 6:168542561-168542583 CTGTTACAGAGGAGGGTTTGGGG + Intronic
1021394350 7:20128988-20129010 ATGAGAAAGAGAAAGGTAAGGGG + Intergenic
1021927390 7:25546373-25546395 ATGTAAAAGAGGGAGCTATGGGG + Intergenic
1023352720 7:39336304-39336326 CTCTGAAGGTGGAAGGGATGGGG - Intronic
1024228215 7:47344589-47344611 CTGGGAAAGATGTAGGGATGTGG - Intronic
1024544237 7:50503439-50503461 CTCTGAATGAGGAAGGGAGGAGG + Intronic
1025706320 7:63867897-63867919 CTGGGAAAGAAGAAGGGACGTGG + Intergenic
1026695712 7:72589553-72589575 CTGAGAAAGTGGTATGTATGAGG + Intronic
1027461976 7:78465804-78465826 TTCTGAAAGAGGAAGGGATTTGG - Intronic
1027697971 7:81434894-81434916 CAGTGAAATAGAAAGCTATGAGG + Intergenic
1028682523 7:93553039-93553061 TTTTGAAAGAAGAAGGTGTGAGG - Intronic
1028796166 7:94907281-94907303 CTGCCAAAGAGAAAGGGATGAGG - Intronic
1029319739 7:99748151-99748173 CTCTGCAAAAGGAAGGTCTGAGG - Intergenic
1029831678 7:103267035-103267057 CAGTGGGAGAGGAAGGGATGAGG - Intergenic
1030770486 7:113469011-113469033 ATGGGAAAGAGGTAGATATGGGG - Intergenic
1031127042 7:117786579-117786601 CTGTGGAACAGGAGGGAATGGGG + Intronic
1034423649 7:151001798-151001820 CTGCGGGAGAGGAAGGTGTGAGG - Intronic
1035113285 7:156502880-156502902 GTGTGAATGAAGAAGGCATGGGG + Intergenic
1035945356 8:3955634-3955656 CGGTGAAAGAGGAAGTAGTGAGG - Intronic
1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG + Intronic
1036475612 8:9090229-9090251 CTGTGAGAGAGGAAAGGAAGAGG + Intronic
1038520832 8:28230698-28230720 ATGTGGAAGAGGAGGGTTTGTGG - Intergenic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1042726819 8:71888119-71888141 TTTGGAAAGAGGAAGGTTTGAGG - Intronic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1043375646 8:79646575-79646597 CCCTGAAATAGGAATGTATGAGG + Intronic
1045758546 8:105574604-105574626 CTGTGAAATATGAAGAAATGGGG + Intronic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1046555673 8:115769391-115769413 CTGTAAATGCGGAAGGTGTGAGG + Intronic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048300362 8:133246772-133246794 CTGGCAAAGAAGAAAGTATGTGG + Intronic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1052011394 9:23413899-23413921 CTGTGAGAGAGGCAAGTATTTGG - Intergenic
1053777870 9:41567251-41567273 CTATGAGAGAGGAAGGGATGGGG - Intergenic
1058177996 9:101760493-101760515 GTGGGAAAGAGGGAGGGATGGGG + Intergenic
1058507213 9:105678279-105678301 CTGTGACAGAGACAGGTGTGTGG - Intergenic
1059003163 9:110372326-110372348 CTAGGAAAGGGGAAGGGATGTGG - Intronic
1060143944 9:121234937-121234959 CTGAGAAACAGGGAGGTGTGGGG + Intronic
1060215860 9:121737899-121737921 CTGTGAAAGTGCAAGGCTTGGGG + Intronic
1061383953 9:130277156-130277178 CTGGGCAAGAGGAGGGTGTGGGG - Intergenic
1203422083 Un_GL000195v1:2164-2186 CTGGGAAAGAAGAAGGGATGTGG + Intergenic
1186397566 X:9225187-9225209 CTGTGAAGGAGAAAGGCATGGGG - Intergenic
1186538558 X:10375120-10375142 TTGTGAAAGAGGCTGGTTTGAGG + Intergenic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1187007019 X:15241981-15242003 CAATGAAAGAGGAAGGCAAGAGG - Intronic
1187809621 X:23160843-23160865 CTGTGAAAGAAGCAGCTAAGGGG - Intergenic
1190000695 X:46683619-46683641 CTGTGAATAAGGAAGGAGTGTGG + Intronic
1190438210 X:50448870-50448892 CTGTGAAGCAGGGAGGAATGGGG + Intronic
1190440320 X:50469891-50469913 CTGAGAAAGATGCAGGGATGGGG - Intronic
1190751616 X:53366832-53366854 CTAAGAAAGAGGAAGATATGGGG + Intergenic
1190804075 X:53818497-53818519 CTAAGAAAGAGGAAGATATGGGG + Intergenic
1192556358 X:72092671-72092693 CTGTGAGTGAGGGAGGCATGGGG + Intergenic
1194409642 X:93542348-93542370 CTGGGAAAGAGAAAGAAATGGGG - Intergenic
1194834313 X:98662064-98662086 GTGTGAAAGAGGAACTTTTGAGG + Intergenic
1195059407 X:101179168-101179190 CTGGGAAAAGGGAAGGAATGAGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195966425 X:110434001-110434023 CTGTGGTAGAGGAACGTATCTGG + Intronic
1196661365 X:118273649-118273671 CATTGAAAGAGGAAGGGATTAGG + Intergenic
1197263613 X:124342804-124342826 CTGAGATAGAGGAAAGGATGGGG - Intronic
1197737159 X:129859619-129859641 CAGTCAAAGAGGATGGTTTGGGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1197868627 X:131044888-131044910 CAGTGAAAGAAAAAGGGATGAGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199787241 X:151116459-151116481 CTCTGAAGGAGCAAGGTGTGAGG - Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic