ID: 963500691

View in Genome Browser
Species Human (GRCh38)
Location 3:146121689-146121711
Sequence GTTTTTCAGGGAATTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963500686_963500691 -5 Left 963500686 3:146121671-146121693 CCTACTGAACCAAAATGGGTTTT 0: 1
1: 0
2: 0
3: 17
4: 184
Right 963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 255
963500683_963500691 10 Left 963500683 3:146121656-146121678 CCTTTAAGCAATTTTCCTACTGA 0: 1
1: 0
2: 1
3: 17
4: 219
Right 963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 255
963500682_963500691 23 Left 963500682 3:146121643-146121665 CCTTGATGAGGGGCCTTTAAGCA 0: 1
1: 0
2: 1
3: 9
4: 89
Right 963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963500691 Original CRISPR GTTTTTCAGGGAATTGCAGA GGG Intronic
900924529 1:5695416-5695438 GGTTGTCAGGGATTTGAAGATGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902660383 1:17896749-17896771 GTTTTCCAGGGCATCCCAGAAGG + Intergenic
902757180 1:18556674-18556696 TTTTTTCAGGGACTAGGAGATGG + Intergenic
904079376 1:27862507-27862529 GGGTTTCAGGGAAGGGCAGAGGG + Intergenic
905913770 1:41671399-41671421 GTTTCTCCGGCAATTCCAGAAGG - Intronic
906526313 1:46495168-46495190 GATTCTAGGGGAATTGCAGATGG - Intergenic
910892444 1:92031420-92031442 GTGTTTTATGGAATTCCAGATGG - Intronic
911382952 1:97138806-97138828 ATTTTCCAGGGATTTGGAGAAGG + Intronic
911617574 1:100031640-100031662 TTTTTTCAGCCAAATGCAGATGG - Intergenic
911672446 1:100622203-100622225 GTTTCCCAGAGAAATGCAGAGGG - Intergenic
912389193 1:109290214-109290236 GTAATTCAGGGAACAGCAGAGGG + Intergenic
912394919 1:109335106-109335128 GGTGTTCAGGGAATGGCAGGGGG + Intronic
912746118 1:112247131-112247153 GTCCTTCAGGGAATTCCACAAGG - Intergenic
913439534 1:118883459-118883481 ATGTCCCAGGGAATTGCAGATGG - Exonic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915860573 1:159440165-159440187 GTATCTCAGGGGGTTGCAGATGG - Exonic
915874544 1:159598671-159598693 GTATCTCAAGGGATTGCAGATGG - Intergenic
920854239 1:209650574-209650596 GTTTTCCAGTGAATTGTAGCTGG - Intronic
921452975 1:215331643-215331665 GTTTTTCATTGAATTTCATAAGG + Intergenic
921869835 1:220128100-220128122 TTTTTTCAATGAAATGCAGATGG + Intronic
921920468 1:220663537-220663559 GTTTTTCAGGAGTGTGCAGATGG - Intronic
923102109 1:230824814-230824836 GGTTTTCAAGGATGTGCAGAGGG + Intergenic
924309854 1:242728888-242728910 GGTTGTCAGGGACTTGGAGAGGG - Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1064784764 10:18881605-18881627 CTTTTTGAGGCAATTACAGAGGG + Intergenic
1066572249 10:36786325-36786347 TTTTTTCTGGCAATTGGAGATGG - Intergenic
1066810023 10:39318357-39318379 GTTTTTCTGGAATCTGCAGAGGG - Intergenic
1067226812 10:44382126-44382148 GGTTTTCAGGGAGTTGCATTTGG - Intronic
1067896264 10:50183167-50183189 ATTGTTCAGGGAATTAGAGAGGG - Exonic
1067952715 10:50758860-50758882 ATTGTTCAGGGAATTAGAGAGGG + Intronic
1072490622 10:95902595-95902617 GTTTTGCAGGGGAAAGCAGAGGG + Intronic
1072813087 10:98478754-98478776 ATTCTTCAGGGAATAGCTGAAGG - Intronic
1073267058 10:102234175-102234197 CTTTCTCAGGGAGGTGCAGATGG + Intronic
1076162150 10:128253233-128253255 CTTTTTCAGCGCATTGTAGAAGG + Intergenic
1077751331 11:4973483-4973505 GTATCTCAGGGGGTTGCAGATGG + Intronic
1078420582 11:11208807-11208829 GTGATTCAGGGAAGTGCACAGGG + Intergenic
1079561723 11:21829686-21829708 GTCTTACAGGGAATAACAGAAGG - Intergenic
1081514368 11:43811107-43811129 AGCTTTCAGGGAATTGCAAAAGG - Intronic
1084260373 11:67973923-67973945 AGTTTTCAGGGAATTCCAAAAGG + Intergenic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1087840370 11:102914574-102914596 GTTTTTCAGGGAGCTGCCAAGGG + Intergenic
1088778869 11:113114257-113114279 CTGTTTCAGAGCATTGCAGAGGG + Intronic
1090879051 11:130817152-130817174 GCTCTTCGGGGAGTTGCAGAGGG + Intergenic
1092952022 12:13513734-13513756 TTTTTGCAGGAAATTGAAGAAGG - Intergenic
1093560168 12:20529183-20529205 GTTTTTCCAGAAAGTGCAGAAGG + Intronic
1094350652 12:29521224-29521246 GTTTTTGAGGGAAGTAGAGAGGG + Intronic
1094876480 12:34650415-34650437 GTTTTTCTAGAAACTGCAGAGGG + Intergenic
1095737327 12:45571875-45571897 GTTTTTGATGGAAATGAAGAAGG - Intergenic
1096688877 12:53307420-53307442 CTTTTCCAGGGAGTTGCAGTGGG - Intergenic
1096889166 12:54749371-54749393 GTTTTACAGTGACCTGCAGATGG + Intergenic
1097078054 12:56409779-56409801 GCTTGTCCGGGATTTGCAGAAGG - Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100090927 12:90970064-90970086 GATTTTCTGGGAGTGGCAGAGGG + Exonic
1102772030 12:115486398-115486420 GATCTTCAGGGAATTGCTTAAGG + Intergenic
1107164670 13:37270484-37270506 GTTTTTCAAGACATTGCAGGCGG + Intergenic
1107607581 13:42076055-42076077 CTTTTTCTGGAAATTCCAGATGG + Intronic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1111620285 13:90716342-90716364 ATTTTCCAGGGCATGGCAGATGG + Intergenic
1112619128 13:101036711-101036733 GGGTGTGAGGGAATTGCAGAGGG + Intergenic
1114731781 14:25000634-25000656 GTTTTACACAGAAATGCAGAGGG - Intronic
1114731785 14:25000684-25000706 GTTTTACACAGAAATGCAGAGGG + Intronic
1115131291 14:30055162-30055184 CTTTTTCATGGTATTTCAGAGGG + Intronic
1115445764 14:33487746-33487768 GTTTTACAGGAAATTTCAAATGG - Intronic
1115590724 14:34862574-34862596 GTTTTTCACTGAAAAGCAGATGG - Intronic
1116408826 14:44599530-44599552 CTTTTTCAGGGAATTGCTTGTGG - Intergenic
1116603442 14:46958302-46958324 GATGTTCAGAGAAATGCAGATGG + Intronic
1117617466 14:57548269-57548291 CATTTTCAGGGAAGTACAGAGGG - Intergenic
1118278756 14:64409984-64410006 GTTTCTCCCAGAATTGCAGAGGG - Intronic
1119274226 14:73339056-73339078 CTTTTACAGAGAATTGCAGTGGG - Intronic
1120601360 14:86514247-86514269 GTTTTTCAAGGAAGACCAGAGGG - Intergenic
1121775258 14:96586338-96586360 GTGTTTCTGGCAAGTGCAGAAGG - Intergenic
1122586016 14:102807161-102807183 GGTTTTCAGGGAAGGGCAGGAGG - Intronic
1122883132 14:104699029-104699051 GTCTTTCAGGGGCTTGCACAGGG + Intronic
1123850934 15:24355853-24355875 CTTTTTCAGGGTATTGGAGGTGG + Intergenic
1126558034 15:50011735-50011757 ACATTTCAGGGAATTTCAGAAGG - Intronic
1134678236 16:16105362-16105384 AGTTTTCAGGGAGTGGCAGAGGG - Intronic
1134913211 16:18047474-18047496 GATCTGCAGGGAATTACAGATGG - Intergenic
1135396765 16:22137654-22137676 GTTTTTAAGGGTTTTGCAGTGGG + Intronic
1136739647 16:32505356-32505378 GTTTTTGAGGAAACTGCAAATGG - Intergenic
1137101078 16:36385461-36385483 GTTTTTCTGGGATTTGCAAGTGG + Intergenic
1137146267 16:37134287-37134309 GTTTTTCTGGAAATTGCAAGTGG + Intergenic
1137170702 16:37538500-37538522 GTTTTTCAGGAATTTGCAAGTGG + Intergenic
1137170971 16:37542909-37542931 GTTTTTCAGGAATTTGCAAGTGG + Intergenic
1137172040 16:37560564-37560586 GTTTTTCTGGGATTTGCAAGTGG + Intergenic
1137173439 16:37583665-37583687 GTTTTTCTGGAATTTGCAAATGG + Intergenic
1137186036 16:37791882-37791904 GTTTTTCTGGAATTTGCAAATGG + Intergenic
1137195515 16:37949248-37949270 GTTTTTCTGGGATTTGCAAGTGG + Intergenic
1139438562 16:66951323-66951345 GTTTTTCAGGGGATTAAACATGG - Intergenic
1140595239 16:76401288-76401310 CTTTTTGAGGTAATTGCAAATGG + Intronic
1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG + Intronic
1142025380 16:87810180-87810202 CTTGTCCAGGGAATTGCAGTGGG - Intergenic
1203013269 16_KI270728v1_random:321981-322003 GTTTTTGAGGAAACTGCAAATGG + Intergenic
1203031604 16_KI270728v1_random:595140-595162 GTTTTTGAGGAAACTGCAAATGG + Intergenic
1203040117 16_KI270728v1_random:739291-739313 GTTTTTGAGGAAACTGCAAATGG - Intergenic
1142509379 17:384928-384950 GTTTTTCAGGAGATGGGAGATGG + Intronic
1144476379 17:15592775-15592797 GTGTTTGTGGGAATTGCAGTGGG - Intronic
1144534056 17:16069886-16069908 GATTTTCAGCCAATTGCATAAGG - Intronic
1144921879 17:18770627-18770649 GTGTTTGTGGGAATTGCAGTGGG + Intronic
1150060946 17:62067835-62067857 GTTTTTCAGGGAACGGGAAATGG - Intergenic
1154282930 18:13023761-13023783 CTTTTTCAGAAAATAGCAGAGGG - Intronic
1156846866 18:41675981-41676003 GTTTCTCATGGACTTGCATAAGG - Intergenic
1157588259 18:48818903-48818925 GTTTTTCTGTGAATGGCAGCAGG + Intronic
1157733506 18:50025401-50025423 GTTTTTAAGGGGATCACAGAGGG - Intronic
1157998596 18:52589154-52589176 CTTTTTTAGCAAATTGCAGAAGG + Intronic
1159873083 18:73780361-73780383 GTTTGTCAGGCAGGTGCAGAGGG - Intergenic
1160312661 18:77810456-77810478 GTATTTCAGGGAACTGCAAAGGG - Intergenic
1160318732 18:77870815-77870837 TTTTGTCAGCGAATTGTAGAAGG - Intergenic
1162326516 19:10002840-10002862 GATTTTCAGGGGGTCGCAGATGG - Intronic
1164925040 19:32123951-32123973 GGCTTTCAGGGAATTGCAAGTGG + Intergenic
1165010098 19:32839766-32839788 CTTTATAAGTGAATTGCAGATGG + Intronic
1165317023 19:35062462-35062484 ATACTCCAGGGAATTGCAGAGGG - Intronic
1165715652 19:38044178-38044200 GGTTTGCAGGGAGTGGCAGAAGG + Intronic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
929059403 2:37907640-37907662 GTTGTTCAGTGAACTGTAGAAGG - Intergenic
929070547 2:38025985-38026007 GTTTTTAAGGAAAATGAAGAAGG - Intronic
930132592 2:47868077-47868099 GTTGTCCAGGGATTTGCAGTGGG - Intronic
930534121 2:52626427-52626449 ATTTTTCAGGGGATTGCTTAAGG - Intergenic
931355715 2:61536983-61537005 GTTTTTCAGGGGCCTGCACATGG - Intronic
932383774 2:71311364-71311386 GTTTTTCAGGGTGATACAGAAGG + Intronic
932672769 2:73752645-73752667 GTCTTTCTGGGAATTACAAAGGG - Intergenic
933686350 2:85144655-85144677 GTTATTTTGGGAATTGCAGAGGG + Intronic
935456547 2:103275540-103275562 CTTTTTCAGAGAAATGAAGAAGG - Intergenic
935482437 2:103609444-103609466 TTTTTTCAGAGAATTACACATGG - Intergenic
935658427 2:105444429-105444451 ATTGTTCTGGGAAGTGCAGAAGG - Intergenic
939964186 2:148594414-148594436 GTGTTTCAGGAAATTTCAGATGG + Intergenic
940864430 2:158803974-158803996 GTTTTTCAGTGAAATGCCTAAGG + Intronic
941647559 2:168057641-168057663 ATTTTCTAGGGAAATGCAGAAGG - Intronic
942053871 2:172164689-172164711 ATTTTTCATGGAATGGCAGTAGG + Intergenic
942553521 2:177146780-177146802 TTTTTTCATGGAATTGCTAAAGG + Intergenic
943037031 2:182759880-182759902 TTTTTTTAAGCAATTGCAGATGG - Intronic
944911849 2:204318204-204318226 GTGATTCTGGGAATTGCACAGGG - Intergenic
945547026 2:211168255-211168277 ATTATTCAGGGAAATCCAGATGG + Intergenic
946780384 2:223188704-223188726 ATTTTTCTGGAATTTGCAGAAGG + Intronic
947238739 2:227971431-227971453 ATTTTTCAGTGGATCGCAGAGGG - Intergenic
947381783 2:229552233-229552255 ATGATTCAGGGAAATGCAGACGG + Intronic
948499460 2:238381309-238381331 GTTTCTTTGGGACTTGCAGATGG + Intronic
1169312236 20:4553820-4553842 GTTATTCAGGGGATTCCAGATGG + Intergenic
1169939881 20:10925494-10925516 GTTCTTCAAGGGATGGCAGAGGG + Intergenic
1170359764 20:15533297-15533319 CTTTTTAAGAGAATTGCAGAAGG + Intronic
1172462292 20:35128600-35128622 GTCCTTCAAGGAATTCCAGAAGG + Intronic
1173928864 20:46801547-46801569 GTCTTTCAGGGAAAGTCAGATGG + Intergenic
1173933851 20:46844536-46844558 TTTCTGCAGGGAATTGCAGACGG - Intergenic
1174770824 20:53298504-53298526 GTGTTTCAGGGAAAGGCAAAAGG + Intronic
1175256954 20:57653297-57653319 GATTTTCAGGGGACAGCAGAGGG - Intronic
1178231602 21:30791274-30791296 GGTTTTCAGGGAAGTGTTGAAGG + Intergenic
1179667373 21:42922174-42922196 GATTTTAAGGGTAATGCAGAAGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183314834 22:37131229-37131251 GTTTTCCAAGGAGTTCCAGAAGG + Intronic
950791005 3:15471979-15472001 TTTTTTCAGGGATTGTCAGAAGG + Intronic
951437806 3:22685272-22685294 GTTTATCTGAAAATTGCAGATGG + Intergenic
951448922 3:22814526-22814548 GGGCTTCAGGTAATTGCAGAAGG - Intergenic
953155643 3:40370091-40370113 GTTTTTCAGGCTATTGTAAATGG - Intergenic
953655208 3:44846019-44846041 GTTTATCTAGGAATAGCAGAGGG - Intronic
954187547 3:48930058-48930080 ATTTCTCAGTGAAGTGCAGAAGG - Intronic
957465418 3:80583618-80583640 TTTTCTCAGGAAATTGGAGAAGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
958680616 3:97326149-97326171 GACTCTCAGGGAATTTCAGATGG + Intronic
959012368 3:101092733-101092755 GTCTTCCAGGGAATCCCAGATGG - Intergenic
960823174 3:121756145-121756167 GTTTTTCAGGCAATTGCTTTTGG + Intergenic
960972398 3:123149216-123149238 GTTTTTCAGGCATTTCCAGCTGG - Intronic
962857848 3:139365491-139365513 TTTTCTCAGGAAATTGCTGAAGG + Intronic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
963887002 3:150594091-150594113 CTTTTTCATGGAATTTCAAATGG + Intronic
964106468 3:153045578-153045600 GTCTTTCAGGGAATGGAGGAAGG + Intergenic
965319047 3:167228817-167228839 GTTTTTCCAGGAATTTGAGAAGG + Intergenic
966441605 3:179951036-179951058 TTTTGTCAGGGAAATGCTGAAGG + Intronic
967588797 3:191247378-191247400 GTTTTTCAGGAATCTGAAGAAGG + Intronic
967668712 3:192206186-192206208 GTTTTTCAGGGAAAGGGAAAAGG - Intronic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
970932373 4:21527687-21527709 GTTTTTCAAGGCATTGTAAATGG - Intronic
971793226 4:31195900-31195922 GTTTTTCAGGGGACTACACAAGG - Intergenic
973240908 4:47954766-47954788 GTTTTCCAGGGAATCCCTGAAGG - Intronic
975271820 4:72444193-72444215 GTTTTTCTAGGAATAGGAGAAGG - Intronic
977768882 4:100833110-100833132 GTCTTTCAGGGAAATGCATATGG + Intronic
977904846 4:102465723-102465745 TTTTTTCATGGAATTGGAGAGGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
979096068 4:116553079-116553101 GTTTTTCAGGCAATGGCAGTGGG + Intergenic
979556364 4:122051918-122051940 GTTTTTCAGGGGATGACAGACGG + Intergenic
980514436 4:133836262-133836284 GTTTTTCAAGTGATTGCAAAAGG + Intergenic
980859748 4:138485054-138485076 ATGTTTTAGGGAATTACAGAGGG - Intergenic
981812590 4:148792800-148792822 GTTTTTCAGGGAAGTGTGGTAGG - Intergenic
983263773 4:165486182-165486204 CTTTTCCAGAGAATTGCTGATGG - Intronic
983907311 4:173197608-173197630 GTTCTTGTGGGAATTGCACAAGG + Intronic
984933946 4:184873700-184873722 GGTTTTTAGAGAATTACAGATGG + Intergenic
985051066 4:185991679-185991701 GTTTTCCAGTGACTTGGAGATGG - Intergenic
985084985 4:186303947-186303969 GTTGTCCAGGGCTTTGCAGATGG + Intergenic
985244991 4:187971342-187971364 TGTTTTCATGGAATTGCAGCAGG - Intergenic
986050739 5:4087905-4087927 GTTTTGAAGGGATTTGCATATGG + Intergenic
987007114 5:13722157-13722179 GTTTCTCCGGGAATTGGAGTGGG - Intronic
987776157 5:22369456-22369478 GTTGTTCAGGGAATTAAATATGG - Intronic
988396331 5:30701211-30701233 CTTTTTTAGGGCATTGCAGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989853398 5:46245289-46245311 GTTTTTCAGGAATCTGCAAAGGG - Intergenic
991089475 5:62680059-62680081 ATCTTTCAGGGGATTGGAGAGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
993075738 5:83228042-83228064 GTTTTTCAGGGAATTACCCTTGG - Intronic
993832460 5:92777044-92777066 GATTTTCAGTGAACTTCAGAAGG + Intergenic
997836348 5:137196334-137196356 GGTTTTCAGGCAGATGCAGAGGG - Intronic
999045495 5:148464504-148464526 TATCATCAGGGAATTGCAGATGG + Intronic
999841531 5:155432777-155432799 GTTTCTCAGGGACTGGGAGAAGG - Intergenic
1000313888 5:160070579-160070601 GTTTTGCAGGGAATGGGACAAGG - Intronic
1001698462 5:173689949-173689971 TTCTTTCAGGGCATGGCAGAAGG + Intergenic
1001740134 5:174046272-174046294 GTGTTTTAGGGTATTGCTGATGG + Intronic
1004399316 6:15273896-15273918 ATTTTTCAGAGAAATGCAGAAGG - Intronic
1005152184 6:22764801-22764823 TCTTTTTAGGGAATTGCAGCTGG - Intergenic
1005450151 6:25964063-25964085 ATTTTTCAGTGAACTTCAGAAGG - Intronic
1006030193 6:31172179-31172201 GTCTTTGAGGGGATTGCAGAGGG - Intronic
1006334184 6:33411804-33411826 GTGTCTCAGGGATTTGGAGATGG + Intronic
1007058148 6:38909120-38909142 GTTTTTCAGATATTTGGAGAAGG + Intronic
1007706496 6:43794445-43794467 GGTGCTCAGGGAAATGCAGATGG + Intergenic
1007878972 6:45140517-45140539 GTTAGGCAGGGTATTGCAGACGG - Intronic
1007921953 6:45618219-45618241 TTTTTTGAGGAAATTGCTGAGGG + Intronic
1008691434 6:53983531-53983553 GTTTCACAGGGAATTCCTGAGGG + Intronic
1008958471 6:57241481-57241503 CTTTTTCAGGAAACTGCTGAAGG + Intergenic
1010938062 6:81885070-81885092 GCTTTTCAGGGCTTTTCAGAAGG - Intergenic
1011712976 6:90073496-90073518 GGTTTTCAAGTATTTGCAGATGG - Intronic
1012659235 6:101865422-101865444 GTTTTTCAGGGAACTTAAAAAGG + Intronic
1013934885 6:115582430-115582452 GTTTTTGAGGGATCAGCAGAAGG - Intergenic
1014735216 6:125086550-125086572 ATTTTTCTGGGAATTGCTGTGGG - Exonic
1014794768 6:125712301-125712323 GAATTTCAGAGATTTGCAGAAGG - Intergenic
1014896294 6:126904084-126904106 GAGTTTCAGGGAATTTCTGAGGG - Intergenic
1015318338 6:131842862-131842884 GTATTTGAGGGAATTGGTGAGGG + Intronic
1015460506 6:133486161-133486183 GTTTTTCATGGAATTCGACAAGG - Intronic
1015669396 6:135671728-135671750 GTTTGCCAGGGAATAGCAGGAGG + Intergenic
1017175841 6:151503875-151503897 TTTTCTCAGTGCATTGCAGATGG + Intronic
1017294590 6:152778833-152778855 CGTTTCCAGGGAATTGAAGAAGG + Intergenic
1018657549 6:166053998-166054020 GAGTTTCAGAGATTTGCAGAGGG - Intergenic
1019402029 7:860680-860702 GACTTTCATGGAACTGCAGAAGG - Intronic
1022822949 7:33979345-33979367 GGTTCTCAGGGAGTTGCAGGGGG - Intronic
1024143052 7:46481253-46481275 CTTTTTCTGGGGATTCCAGATGG - Intergenic
1025520854 7:61727691-61727713 CTTTTTCTGGGATTTGCAGAGGG - Intergenic
1025527149 7:61829017-61829039 GTTTTTGAGGAAACTGCAAATGG - Intergenic
1025545208 7:62157252-62157274 CTTTTTCTGGGATTTGCAGAGGG - Intergenic
1025908477 7:65808568-65808590 GATTTTCAGCAAATTCCAGAGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027659127 7:80967948-80967970 GTTTTGGAGAGAATCGCAGAGGG - Intergenic
1027813226 7:82932537-82932559 AATTTTCAGGTAATTTCAGAGGG + Intronic
1028956959 7:96704303-96704325 CTTTTTTGGGGAATTGTAGAGGG + Intronic
1030083846 7:105800394-105800416 GTTTCTGCGGGAATTGAAGAAGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035976061 8:4312979-4313001 GTTTTGCGGGGAAATGAAGATGG + Intronic
1037466152 8:19162506-19162528 ATTTTTCAGGGAAAAGAAGAAGG + Intergenic
1037781244 8:21870620-21870642 GCTTTCCAGTGCATTGCAGAAGG + Intergenic
1039017478 8:33167892-33167914 GTTTTCCAAAGAATTACAGAAGG - Intergenic
1040768724 8:50947860-50947882 GTTTTTAAGGGAATTTGAAAGGG - Intergenic
1042124564 8:65525121-65525143 GGGGTTCAGGGAAGTGCAGAGGG - Intergenic
1042742979 8:72071842-72071864 GTTTTTGAAGGAAGTGCATATGG - Exonic
1046350241 8:112999946-112999968 GTTTTACAGGTACTTGCATAAGG + Intronic
1048944515 8:139431911-139431933 TTTTATCGTGGAATTGCAGATGG + Intergenic
1056912337 9:90713764-90713786 GGTCTCCAGGGAATTGCAGGTGG - Intergenic
1057286151 9:93756070-93756092 GCTATTCAGGGAATTACAAAAGG - Intergenic
1058136432 9:101313006-101313028 GTTTTTCAGAGAGTAGAAGAGGG - Intronic
1058391875 9:104504636-104504658 GTATCTCAGGGGGTTGCAGATGG - Exonic
1059602031 9:115789199-115789221 GTTTTCCAGTGAATTGCTGCAGG + Intergenic
1060137962 9:121175670-121175692 GTTTTTCAGAGAGTTGAAGGCGG - Intronic
1061868473 9:133507461-133507483 GTTTGTCTGGGAACTGCACAAGG - Intergenic
1062511611 9:136909451-136909473 AGTTTACAGGGAAGTGCAGATGG - Intronic
1187591114 X:20718374-20718396 GTTTTTCTGGGATTGGCAAAAGG + Intergenic
1189190972 X:39105368-39105390 GTTTGTCAAGGATTTGGAGAGGG + Intergenic
1191575673 X:62702466-62702488 GTTTTTCAGGAATCTGCAAAGGG - Intergenic
1193367259 X:80650151-80650173 GTTTGTCAGGGCATAGTAGAGGG - Intergenic
1194904988 X:99564274-99564296 GTTCTTCATGAAATTCCAGAAGG - Intergenic
1195501864 X:105611666-105611688 TTTTGTCTGGGAATTTCAGAGGG - Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195889261 X:109673624-109673646 GTTGTTCTGAGAATTACAGATGG - Intronic
1196599170 X:117582393-117582415 ATTTTTCAGACAAATGCAGAGGG - Intergenic
1197323752 X:125066265-125066287 GTTTTTCTCTGAAATGCAGATGG + Intergenic
1198115105 X:133537139-133537161 GTTTATCAGGAAATTCAAGATGG + Intronic
1199708180 X:150449279-150449301 GTTTTTCATCGTATTGTAGATGG - Intronic