ID: 963502093

View in Genome Browser
Species Human (GRCh38)
Location 3:146140222-146140244
Sequence AAGCTGAGCCAATGCTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963502093 Original CRISPR AAGCTGAGCCAATGCTATAT GGG Intronic
901710210 1:11108184-11108206 AACCTCTGCCAGTGCTATATTGG - Exonic
903557112 1:24202187-24202209 AAGCTGAGACACTGCTGTCTGGG - Intergenic
904351784 1:29912805-29912827 AAACAGAGCCAAGGCTACATAGG - Intergenic
906860415 1:49353363-49353385 AAGATGACCCATTCCTATATTGG + Intronic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
909743961 1:79069257-79069279 AAGCTGAGCCAATTCCAAATAGG + Intergenic
910106220 1:83633908-83633930 AAGCCGAGGCAATGCTACAGCGG + Intergenic
910485272 1:87706220-87706242 AGGCTGAGCCAACTCTAGATTGG - Intergenic
912209426 1:107542460-107542482 AAGCTGTGCCAAAGATAAATAGG - Intergenic
913587377 1:120288903-120288925 AAGCTGAGTGAATGGCATATGGG - Intergenic
913620808 1:120609466-120609488 AAGCTGAGTGAATGGCATATGGG + Intergenic
917952631 1:180056376-180056398 AAGCTCAGCAAATCCTAAATAGG - Intronic
918994770 1:191743158-191743180 TACATGACCCAATGCTATATAGG - Intergenic
923866122 1:237941301-237941323 AAGCTAAGCCCTTGCTAGATCGG - Intergenic
1069257570 10:66352975-66352997 AAGCTGAGCCATAGGTAAATGGG + Intronic
1069584936 10:69593163-69593185 AAGCTAAGCCCTTGCTAGATTGG - Intergenic
1071984785 10:91039522-91039544 AGGCTGAGCTCATGCTAAATTGG + Intergenic
1072704577 10:97671477-97671499 AAACTGGGCAAATGCTATATAGG + Intronic
1080393583 11:31870523-31870545 AAGCTGAGTAAAAGTTATATAGG - Intronic
1081243240 11:40732515-40732537 ACGCTGAGCCAAGACTCTATGGG + Intronic
1085868127 11:80318784-80318806 AGCCTGACCCAATGCTATGTTGG - Intergenic
1088017559 11:105079255-105079277 AAGCTGAAATAATGCTTTATAGG + Intronic
1088238103 11:107746622-107746644 AAGATGGGACAATGCTATCTAGG + Intergenic
1088549643 11:110999458-110999480 AAGCTGAGTGAAAGATATATTGG - Intergenic
1092432946 12:8423631-8423653 AAGCACACCCAGTGCTATATTGG - Intergenic
1096943863 12:55382112-55382134 AGTCTGAGCCAATGCCATAGGGG + Intergenic
1098210148 12:68154949-68154971 AATCTGAGCCAGTGCTTTAATGG - Exonic
1103557065 12:121773089-121773111 AAGCTATGCCAGTGCTATGTTGG - Intronic
1106446628 13:29838660-29838682 AAGCTGAGAGAAAGGTATATGGG + Intronic
1107689660 13:42940216-42940238 AGGCTGAGGCAATGGCATATAGG - Intronic
1111237319 13:85426646-85426668 AAGCTCATCAAATGCTATAATGG - Intergenic
1117503855 14:56381261-56381283 AAGCTTACCCAATGCTGTAGAGG + Intergenic
1119598682 14:75959434-75959456 AAGCTGAGCAAGTGCTAGAATGG + Intronic
1121319794 14:92985389-92985411 AAGCTGTGCAAAGGGTATATGGG + Intronic
1125854623 15:42936988-42937010 CAGCTGAGCCAATACAATGTTGG + Intergenic
1127567924 15:60211607-60211629 AAGCAGATTCAAGGCTATATAGG - Intergenic
1127978671 15:64017991-64018013 AAGATGAGCCATTTCTATAATGG + Intronic
1139946235 16:70644382-70644404 AATCTGAGTAACTGCTATATGGG + Intronic
1140699787 16:77571101-77571123 AAACAGAGACAATGCAATATTGG - Intergenic
1142499725 17:325532-325554 AAGATGGGCCAATGTTAGATGGG - Intronic
1143847284 17:9782096-9782118 TAGTTGAGAAAATGCTATATTGG - Intronic
1146253261 17:31369612-31369634 AAGGAGAGCCAATGCTTTAGGGG + Intronic
1146677484 17:34783549-34783571 AAGCTGAGGCTGTGCTATTTAGG - Intergenic
1148188289 17:45660485-45660507 AAGCTGATCCAAAGCTAACTTGG - Intergenic
1156874132 18:41985796-41985818 AAGCTAATCATATGCTATATGGG + Intronic
1157897548 18:51483343-51483365 AAGCTGAGACAATGGTGTACAGG - Intergenic
927539024 2:23890598-23890620 AAGCTGAGTTAATGCTTTGTTGG - Intronic
928060658 2:28109621-28109643 AAGCTGTGCCATTGGTATAATGG - Intronic
929072620 2:38049003-38049025 AAACTTAGCCAATGCTGTTTAGG + Intronic
931509820 2:62978731-62978753 ATGCTGATCAAATACTATATAGG - Intronic
932601339 2:73128500-73128522 AAGCTGAGTGAAGGGTATATGGG - Intronic
933042943 2:77491909-77491931 AAGATGAGGCAAGGCTATACAGG + Intronic
933669209 2:84990864-84990886 AAGCTGGGCCCAGGTTATATGGG + Intronic
937009247 2:118546949-118546971 AGGCTGAGCTAATGCCATTTAGG - Intergenic
941533348 2:166694924-166694946 ATGCACACCCAATGCTATATTGG + Intergenic
942229993 2:173851814-173851836 AAATTGATCCAATGCTATTTTGG + Intergenic
943290868 2:186069598-186069620 AAGTTTAGCAAATGCTATTTTGG + Intergenic
947143788 2:227044887-227044909 AAGCTGAGGCCATGGCATATGGG + Intronic
948511539 2:238468926-238468948 AAGCTGAGCAAATGGTAAACAGG - Intergenic
1175011903 20:55745965-55745987 AAGTTGAGCCTAAGCTATCTGGG - Intergenic
1179047984 21:37863889-37863911 AAGGTGAGCTTCTGCTATATTGG + Intronic
1179082320 21:38182966-38182988 AAGATGAGCCAAGACTATAAGGG - Intronic
951870799 3:27359725-27359747 AAGCTGAGTGAAGGGTATATGGG + Intronic
962647242 3:137452604-137452626 AAGCTGGGTGAATGGTATATTGG - Intergenic
963502093 3:146140222-146140244 AAGCTGAGCCAATGCTATATGGG + Intronic
964634867 3:158847693-158847715 AAGCAGAGCCAAGGCTGAATGGG + Intergenic
965327172 3:167321112-167321134 AAGCTGAGTGAATGTTATTTGGG + Intronic
965936997 3:174126687-174126709 AACCTGTGCAAATGCCATATTGG + Intronic
967731058 3:192907326-192907348 CACCTGAGCCAAGGGTATATAGG - Intronic
969025781 4:4171268-4171290 ATGCAGACCCAGTGCTATATTGG - Intergenic
969061696 4:4440561-4440583 AAGCTGAGTCAAAGCTAGAAAGG + Intronic
969501969 4:7558864-7558886 AAGGTGAGCCACAGCTCTATGGG - Intronic
970349775 4:15190600-15190622 ACCCTGATCCAAAGCTATATGGG - Intergenic
972158636 4:36196851-36196873 AAGCAGAGACAATGGCATATGGG - Intronic
976270611 4:83227007-83227029 AACCTGAGCAAAGGATATATGGG + Intergenic
979847427 4:125533701-125533723 AATCTGAGTTAATGCTGTATTGG - Intergenic
982377677 4:154712045-154712067 AAACTAAGCATATGCTATATAGG - Intronic
983424867 4:167570606-167570628 AAGCTGAGTTAAATCTATATTGG + Intergenic
984863434 4:184259917-184259939 AGGGTGAGCCAATGGTTTATTGG - Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
1000570403 5:162905741-162905763 AAGCTGAGTGAAAGTTATATGGG - Intergenic
1003777770 6:9388321-9388343 AAGCTGAGCCAATGTTCTGAAGG + Intergenic
1004913603 6:20310682-20310704 AAGCTGAGCAAATCCAAAATAGG + Intergenic
1005392466 6:25347665-25347687 AAGCTGAGTAAAGGGTATATGGG - Intronic
1005695789 6:28351535-28351557 AAGCTGAGTCATGGTTATATTGG - Intronic
1010293443 6:74167222-74167244 GAGCTGAGCCAAGGTTCTATGGG + Intergenic
1011967608 6:93178532-93178554 AAGGAGATCCAATTCTATATTGG + Intergenic
1012377950 6:98585370-98585392 AAGTTGAGCCTATGCTAGAGAGG + Intergenic
1013186211 6:107761238-107761260 AAGCTCAGCAAATCCTAAATAGG + Intronic
1014602715 6:123434872-123434894 AAACTGAGCAATTGGTATATTGG - Intronic
1025731282 7:64110390-64110412 AAGCTAAGCCCTTGCTAGATTGG - Intronic
1026328735 7:69333852-69333874 AAGCTAAGCCCTTGCTAGATTGG - Intergenic
1028580913 7:92408928-92408950 AAGCAGAGCAAATGCTAATTTGG - Intergenic
1032734594 7:134679998-134680020 AAGCAGAGGGAATGGTATATTGG + Intergenic
1037199290 8:16232123-16232145 ATGTTGAGCAAATGCTATAGTGG - Intronic
1039925981 8:41932838-41932860 CAGCTGAGCCAGTCCTGTATTGG + Exonic
1041352266 8:56959295-56959317 AAGCTTTGCCAATGGTAAATTGG + Exonic
1043283929 8:78505257-78505279 AAGCTGAGTAAAGGCTATATGGG + Intergenic
1046436453 8:114195705-114195727 AATCTGAAGCAATGCTGTATGGG + Intergenic
1052346546 9:27415386-27415408 AAGCTGGGTGAATGATATATGGG + Intronic
1056151649 9:83796363-83796385 AAGCTGAGCCAATTCTGTGAAGG - Intronic
1056865289 9:90223100-90223122 ATGCACAGCCAGTGCTATATTGG + Intergenic
1057079537 9:92162317-92162339 AAGCTGAGCAAATCTTAAATGGG + Intergenic
1057641948 9:96832815-96832837 AAGCTGAGTAAATTCTATACAGG - Intronic
1060155338 9:121316265-121316287 AAGCTGAGTGAATGGTATATAGG - Intronic
1062711958 9:137979919-137979941 AAGCTGAGCCACTGGTCCATAGG + Intronic
1187795616 X:23000494-23000516 AAGCTGAGCCATTGTCAAATTGG + Exonic
1187813054 X:23201402-23201424 AAGCTGAGTGAATGATATATGGG + Intergenic
1189215384 X:39318717-39318739 AAGCTGAGCCCAGACTAGATTGG + Intergenic
1189909993 X:45801076-45801098 AAGCTGGGCAAAGGGTATATGGG + Intergenic
1190049058 X:47135824-47135846 AAGCAGAGCCAATACTTTAGAGG - Intergenic
1190954486 X:55178979-55179001 AAGCTAAGCCCTTGCTAGATTGG - Intronic
1192178765 X:68902502-68902524 AAGCTGAGACAGTGCTAGAAAGG + Intergenic
1194419282 X:93652229-93652251 AAATTGTGCAAATGCTATATAGG - Intergenic
1195604821 X:106793433-106793455 AAGCTGGGTGAATGGTATATGGG - Intronic
1195769069 X:108329696-108329718 AAGCTGAGCAATTGGTACATGGG + Intronic
1197631344 X:128863339-128863361 AAGCTGAATGAAAGCTATATGGG + Intergenic
1199782242 X:151073196-151073218 AAGCTGACACAATGATAAATAGG + Intergenic