ID: 963502709

View in Genome Browser
Species Human (GRCh38)
Location 3:146147959-146147981
Sequence CAGAATCTTTCTTGTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963502709_963502712 20 Left 963502709 3:146147959-146147981 CCTCCAAAACAAGAAAGATTCTG 0: 1
1: 0
2: 1
3: 37
4: 366
Right 963502712 3:146148002-146148024 GAAACATAGAACTTAATTTGAGG 0: 1
1: 0
2: 1
3: 21
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963502709 Original CRISPR CAGAATCTTTCTTGTTTTGG AGG (reversed) Intronic
900898281 1:5498880-5498902 CTGAGTCTTCCTTGTTTTGGGGG - Intergenic
903574345 1:24329128-24329150 CAGAAACTTTCCTGTTCTAGGGG - Intronic
904303633 1:29572793-29572815 AACAATCTTTGTTATTTTGGGGG - Intergenic
905096057 1:35471918-35471940 CAAAAAAATTCTTGTTTTGGAGG - Intronic
907166410 1:52415447-52415469 CTGAAATTTTCTTGTTTTGTTGG + Intronic
907344646 1:53764912-53764934 CAAAATCTTTATTGTTTTGAGGG - Intergenic
909467034 1:75983969-75983991 CAGCATCTTTTTTTTTTTGACGG - Intergenic
909505905 1:76389406-76389428 CAGAAGCCTTGTTGATTTGGGGG + Intronic
910324479 1:85989640-85989662 CAGGGTCTTTCGTGATTTGGTGG + Intronic
910552651 1:88493998-88494020 CAGAATAAATCTGGTTTTGGGGG - Intergenic
911421072 1:97641397-97641419 TAAAATCTTTCTTTATTTGGTGG - Intronic
911434361 1:97837072-97837094 CAATATCCTTCTGGTTTTGGAGG + Intronic
911497084 1:98644811-98644833 CAGCCTCTTTCTGGGTTTGGAGG + Intergenic
911716588 1:101140278-101140300 CAAACTCTTTCCTGTTTTGATGG + Intergenic
912143672 1:106763739-106763761 TAGTATTTTTCTTGTTTTGTAGG - Intergenic
913009774 1:114671117-114671139 AAGAATTTTTTTTTTTTTGGTGG - Intergenic
913684702 1:121220737-121220759 CAGACTCTTTCCTTTTTTGTAGG + Intronic
914036538 1:144008353-144008375 CAGACTCTTTCCTTTTTTGTAGG + Intergenic
914152916 1:145059593-145059615 CAGACTCTTTCCTTTTTTGTAGG - Intronic
914849700 1:151305128-151305150 CATAATTTTTCTAGTTTTAGTGG + Intronic
914977911 1:152382718-152382740 CATAATCTTTCTGCTCTTGGAGG - Intergenic
915103011 1:153514182-153514204 TGGAATCTTTGTTGTTTTGTTGG + Intergenic
916065679 1:161133628-161133650 CAGTTTCTTTCTCGTTTAGGGGG + Intergenic
916408322 1:164519707-164519729 AAGCTTCTCTCTTGTTTTGGGGG - Intergenic
917762729 1:178181357-178181379 CAGAATTTTTTTTTTTTTTGAGG + Intronic
918985435 1:191619113-191619135 TATAATCTTTCTTGTTTGAGAGG - Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
919466066 1:197922431-197922453 CACATTCTTCCTTGCTTTGGGGG + Intronic
919555490 1:199047031-199047053 CTGATTCTTTCTCATTTTGGAGG - Intergenic
919883942 1:201919210-201919232 CAGAAACTTTTTTTTTTTTGGGG + Intronic
919940200 1:202281124-202281146 CAGAATTTTCATTATTTTGGTGG - Intronic
920415766 1:205798419-205798441 CAGATTCTTACTTCTCTTGGAGG - Intronic
920472013 1:206239287-206239309 CAGACTCTTTCCTTTTTTGTAGG + Intronic
920514388 1:206573977-206573999 CAGCATCTTTCTTGTTATTTAGG + Intronic
921182991 1:212646034-212646056 CAGGCTCTTTCTTGTCTCGGTGG - Intergenic
922425119 1:225485126-225485148 CAGACTCGTTTTTGTCTTGGGGG + Intergenic
923583327 1:235239977-235239999 CAGAATCTTTCTTGGTTGACAGG - Intronic
924432161 1:244006343-244006365 CAGAATCTTTCTGGTCTTTGTGG - Intergenic
924596482 1:245449372-245449394 CAGTAACTTTTTTTTTTTGGAGG + Intronic
924734901 1:246747032-246747054 TAGATTCTTTTTTGTTTTGTTGG - Intronic
1062995274 10:1859680-1859702 ATGATTCTTTCTTGTTTTTGAGG - Intergenic
1066066808 10:31767434-31767456 CATAATCTTGTTTGTTTTGTTGG + Intergenic
1066728024 10:38411617-38411639 CATATTCTTTCTTTTTTTTGAGG - Intergenic
1068271621 10:54734924-54734946 CAGTATCTTTATTGTGATGGTGG + Intronic
1068442459 10:57076054-57076076 CTGAATCTTTCTTTTTTTCTTGG + Intergenic
1069127779 10:64659088-64659110 CAGAATGTTCATTGTCTTGGTGG - Intergenic
1070649477 10:78224584-78224606 CAGAATATCTCTTCTTTTTGGGG + Intergenic
1071041929 10:81320072-81320094 CAAAATGTTTTTTGTTCTGGTGG - Intergenic
1071141111 10:82510443-82510465 CACACTCTTTCTTATTTTGATGG + Intronic
1071146926 10:82586026-82586048 AAGAATATTTCTTGTTTTGAAGG + Intronic
1071541576 10:86489665-86489687 CTGAATAATTCTTGGTTTGGAGG - Intronic
1071672707 10:87624483-87624505 CTGAACCTGTTTTGTTTTGGGGG + Intergenic
1072244333 10:93528479-93528501 CAAAATATTTTATGTTTTGGGGG + Exonic
1075373589 10:121958779-121958801 CAGGATTGTTCTTGGTTTGGTGG - Intronic
1076271818 10:129159492-129159514 AGGATTCTTTCTTCTTTTGGAGG - Intergenic
1079770067 11:24447047-24447069 CAGCTTCTTTCTTGTTCTGTAGG - Intergenic
1080964998 11:37204128-37204150 AAGAATCATTCTTTTTTTGTGGG + Intergenic
1082129275 11:48468673-48468695 CAGAAGCTTTCTAATTTTGGGGG + Intergenic
1082247803 11:49945017-49945039 CAGAAGCTTTCTAATTTTGGGGG - Intergenic
1082562809 11:54639565-54639587 CAGAAGCTTTTTAATTTTGGGGG + Intergenic
1082920945 11:58493123-58493145 CTGAATTTTTTTTTTTTTGGAGG - Intergenic
1083530451 11:63417247-63417269 CAGAATTCTTGTTGTTTTTGGGG - Intergenic
1083802398 11:65054083-65054105 CAAAATATGTCTTGTTTTTGGGG - Intronic
1083948188 11:65937842-65937864 CAGATTCTTGCCTGTTCTGGAGG + Intergenic
1085569144 11:77544053-77544075 CAGTGTCTTTTTGGTTTTGGAGG - Intronic
1086344392 11:85881373-85881395 CTGAAACTTTTTTTTTTTGGGGG - Intronic
1086744834 11:90411822-90411844 CTGAATCTTTTTTGTTTTTGAGG - Intergenic
1087897369 11:103601594-103601616 CATAGGCTTCCTTGTTTTGGGGG - Intergenic
1088012769 11:105022990-105023012 CTGAATCTTTCTCTTATTGGTGG - Intronic
1090112947 11:123935345-123935367 TGCAATCTTTCTTTTTTTGGAGG + Intergenic
1091096703 11:132829712-132829734 CAGAATCCTTTCTGTTTTTGGGG + Intronic
1091735092 12:2914632-2914654 GATACTCTTTCTTGTTTTTGAGG + Intronic
1092679130 12:10957899-10957921 CAGAATCTGTTGTTTTTTGGGGG - Intronic
1095650362 12:44600613-44600635 CAAGATCTTTCTCTTTTTGGGGG - Intronic
1095817380 12:46439653-46439675 CAGAAACTTTCCTTTTCTGGGGG - Intergenic
1096581695 12:52589777-52589799 CAGAAACTGACTTGCTTTGGTGG - Intronic
1096772370 12:53944154-53944176 CAGAATTTGTTCTGTTTTGGTGG + Intronic
1097369090 12:58754176-58754198 AAGCATCTGTTTTGTTTTGGGGG - Intronic
1099803317 12:87483956-87483978 CTGATTCTTTATAGTTTTGGTGG + Intergenic
1100097104 12:91054183-91054205 AAGAATTTTTGTTTTTTTGGTGG - Intronic
1100891263 12:99128791-99128813 CAGAACTTTTCTTGTTTTCTTGG - Intronic
1100956328 12:99913171-99913193 TGGAAGCTTTTTTGTTTTGGAGG - Intronic
1101819736 12:108174523-108174545 CATTAGCTTTCTTGGTTTGGAGG - Intronic
1101925619 12:108969175-108969197 CAGAGTCATTTTTGTTTTGATGG - Intronic
1102399352 12:112615225-112615247 TAGAAGCTTTGTTGTTTTGAGGG + Intronic
1103502058 12:121410541-121410563 CAGCATTTTTTTTTTTTTGGTGG - Intronic
1103522324 12:121544610-121544632 CTGATTTTTTCTTTTTTTGGGGG - Intronic
1104231039 12:126884205-126884227 CAGAATAACTCTTGCTTTGGGGG - Intergenic
1105356926 13:19667171-19667193 AAGTTTCTTTCTTTTTTTGGTGG - Intronic
1105947164 13:25200043-25200065 CACCATCTTTCTTTTTATGGTGG - Intergenic
1106084181 13:26525561-26525583 CTGATTTTTTCTGGTTTTGGAGG + Intergenic
1106269946 13:28142923-28142945 CAGAATTGTTTTTGTTTTGTTGG + Intronic
1106470857 13:30052839-30052861 CATAAACATTTTTGTTTTGGGGG + Intergenic
1107234326 13:38150806-38150828 CAGAATCTGACTGTTTTTGGAGG - Intergenic
1107380789 13:39854865-39854887 CAGACTCTTTCCTGTGTTGCTGG - Intergenic
1107854569 13:44602271-44602293 AAGAATATTTTTTGTTTTGGTGG + Intergenic
1108965975 13:56302301-56302323 CAAAATTTTTTTTTTTTTGGCGG - Intergenic
1109563748 13:64083238-64083260 GAGGATCTTTTGTGTTTTGGTGG - Intergenic
1109900012 13:68755909-68755931 CAAAATCTTCTTTGTTTTGTTGG + Intergenic
1110365748 13:74683426-74683448 CAAAATATTTCTTGTCATGGAGG - Intergenic
1110993212 13:82070048-82070070 CAGGATCTTTCTATTTTTAGTGG + Intergenic
1111110065 13:83695537-83695559 CAGTATCTTACTTGTCTTGCTGG - Intergenic
1111301402 13:86355396-86355418 CTTAATATTACTTGTTTTGGGGG + Intergenic
1111499721 13:89101843-89101865 AAGAATCTTTCTTGGTCAGGTGG - Intergenic
1111549410 13:89786959-89786981 CAGAATTTTTCTTAGTTTGAAGG + Intergenic
1112074376 13:95893958-95893980 CAGAATGTTTCTTGCTTGGGCGG + Intronic
1113048225 13:106179880-106179902 CAGAAGCTTTTTTGTTTAGCTGG - Intergenic
1113529240 13:111008380-111008402 CAGAACCTTTGTTGTGGTGGAGG + Intergenic
1113647616 13:112010306-112010328 CATTTTCTTTCTTTTTTTGGTGG - Intergenic
1114564940 14:23623727-23623749 CAAACTTTTTCTAGTTTTGGAGG - Intergenic
1114638161 14:24200516-24200538 CAAAATCTTTTTTGTTTTTTTGG + Intronic
1114814389 14:25939663-25939685 CAGCATCTTTCTGGATTTTGTGG - Intergenic
1115171403 14:30511927-30511949 AAGCATTTTTATTGTTTTGGGGG + Intergenic
1115171854 14:30517398-30517420 AAGCATTTTTATTGTTTTGGGGG - Intergenic
1115997918 14:39212470-39212492 CAGCCTCTTTCTTGGGTTGGGGG - Intergenic
1116134616 14:40906113-40906135 CAGCCTCTTTCTGTTTTTGGTGG + Intergenic
1116152429 14:41158305-41158327 AAAAATGTTTCTTGTGTTGGGGG + Intergenic
1116937039 14:50751386-50751408 CAGACTCTTTCATGCTTTGCTGG - Intronic
1117321665 14:54630001-54630023 CAGAATCTTCTTCCTTTTGGAGG + Intronic
1117324051 14:54652640-54652662 CAGAATCTTTTTTTTTTTAAAGG + Intronic
1118629121 14:67686880-67686902 CAGAATTTTTCTGGTCTTTGTGG + Intronic
1118880037 14:69818041-69818063 CAGAATCCTTCCTGTCCTGGGGG + Intergenic
1119074682 14:71624303-71624325 CTTAATGTTTCTTGTTTTGATGG + Intronic
1120361416 14:83507786-83507808 GAGAATATTGCTTGTTTTGAAGG - Intergenic
1120474958 14:84975185-84975207 CAGGATCTTTGCAGTTTTGGTGG + Intergenic
1126756801 15:51933231-51933253 GAGAAGGTTTCTTGTTTAGGTGG - Intronic
1127246929 15:57187174-57187196 CAGAATCTTTTTTTTTTTTTTGG - Intronic
1127334994 15:57975560-57975582 CAAAATGTTTCAAGTTTTGGGGG + Intronic
1129591867 15:76922532-76922554 CAGAATATTACTTGTTTTTAAGG + Intergenic
1130857260 15:87851457-87851479 CAGATTCTTTCTCTTTTTAGAGG + Intergenic
1131068951 15:89452275-89452297 GATAATTTTTCTTTTTTTGGGGG + Intergenic
1135503744 16:23018726-23018748 CAGAAACAGTCTTATTTTGGGGG - Intergenic
1137757002 16:50910385-50910407 CAGATTATTCTTTGTTTTGGGGG + Intergenic
1137782571 16:51110118-51110140 TAGACTCTCTTTTGTTTTGGAGG - Intergenic
1137985359 16:53102843-53102865 CTGTCTCTTTCTTTTTTTGGGGG + Intronic
1138911543 16:61405806-61405828 CGGAATCTTTCTTGTTAAGATGG + Intergenic
1140525419 16:75618841-75618863 CAGAAAATTTTTTGTTGTGGGGG + Intronic
1143593492 17:7900093-7900115 CAGAATTTTTGTTGTTTTTTAGG - Intronic
1143932926 17:10449670-10449692 CAGTAACTTTCTGGATTTGGTGG + Intronic
1145075905 17:19854549-19854571 CAGACTCTTACCTGTTTTTGAGG - Intronic
1145079731 17:19884658-19884680 CCAAATCTTTCTTGTATTTGGGG + Intergenic
1146787788 17:35733706-35733728 GAGAACCTTTCTTCTTTTGTTGG - Intronic
1146909228 17:36637593-36637615 CAGAGTCTTCCTGGTATTGGTGG - Intergenic
1149752342 17:59157704-59157726 TAGAATTTTTTTTTTTTTGGGGG - Intronic
1150503981 17:65680082-65680104 AAAAATCTGTCTTGTTTTAGAGG + Intronic
1150897839 17:69234638-69234660 CAGAATTATTGTTGTTATGGGGG + Intronic
1150933364 17:69609641-69609663 CAGATTATTCCTTGTTGTGGGGG + Intergenic
1151538336 17:74750930-74750952 CAGATTCCTGCATGTTTTGGAGG + Intronic
1151604255 17:75126251-75126273 CAGATGCTACCTTGTTTTGGAGG - Intronic
1156643755 18:39134787-39134809 CACCATCTTTCTTTTTTTTGTGG + Intergenic
1157638246 18:49184235-49184257 CAAAATTTTTTTTTTTTTGGCGG + Intronic
1158618250 18:59007425-59007447 CAGAATGTATTTTGATTTGGAGG + Intergenic
1159890079 18:73944769-73944791 GAGAAGCTTTCTTGTCTTGAAGG + Intergenic
1160047274 18:75398563-75398585 AGGAATCTTTGTTGTTTTAGTGG + Intergenic
1160616475 18:80133830-80133852 CAGAATTTTTTTTTTTTTTGGGG + Intronic
1161749859 19:6087712-6087734 CAGAATTTATTTTGATTTGGAGG + Intronic
1162582929 19:11541259-11541281 CAGGATCATGGTTGTTTTGGGGG - Intronic
1162671395 19:12260546-12260568 CTGACTCTTTATTGCTTTGGGGG - Intronic
1163833811 19:19561388-19561410 CAGATTTTTTTTTTTTTTGGGGG - Intergenic
1165297312 19:34937886-34937908 CAGAATCATTTGTATTTTGGAGG - Intronic
1166590469 19:43993361-43993383 CAGGATGTTTCTAGTTTTAGAGG - Intronic
925320416 2:2962108-2962130 CCGAATGTTACTTATTTTGGAGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925476581 2:4223513-4223535 CTGACTCTTTCTTAGTTTGGGGG - Intergenic
926136687 2:10341591-10341613 CAGCAGCTTTCTTGTGTTGAGGG - Intronic
927369481 2:22337896-22337918 CATCATCTTCCTTTTTTTGGGGG + Intergenic
927585798 2:24303712-24303734 CAGTATCTTTCTTGTAATAGGGG + Intronic
927770009 2:25851893-25851915 CATTTTCTTTCTTTTTTTGGTGG - Intronic
928740271 2:34343522-34343544 CAGAATTTCTCTTCTTTTTGTGG + Intergenic
928832133 2:35499956-35499978 GTCAATCTTTCTTGTTTTGTTGG - Intergenic
929012822 2:37462506-37462528 CAGAAACTTTCTTATGTTGTTGG - Intergenic
929023294 2:37575377-37575399 CAGGATCTTTTTTCTTTTTGAGG + Intergenic
929365433 2:41150148-41150170 AAGAAGCTTTTTTTTTTTGGAGG + Intergenic
929422144 2:41803234-41803256 CAGAAGCCTTCTTGATATGGTGG + Intergenic
929624662 2:43394330-43394352 CAGCATATTTCTTGTTTTCAAGG + Intronic
930283548 2:49400342-49400364 TAGAATCATTGTTTTTTTGGGGG - Intergenic
930874294 2:56196684-56196706 CAGAATCTTCTTTGTCTTGAAGG - Intronic
931225675 2:60327763-60327785 AAAAATGTTTCTTCTTTTGGTGG + Intergenic
931318830 2:61156888-61156910 TAGAATCTTTTTTGTTGTTGTGG - Intronic
931342649 2:61416804-61416826 CCTAATCTTTTTTTTTTTGGGGG + Intronic
931729532 2:65140794-65140816 CAGAATTTTTTTTTTTTTGGGGG - Intergenic
932053496 2:68421766-68421788 TAGAATCTTTCCTGTCTTGCTGG - Intergenic
932932588 2:76059967-76059989 CATAATTTATCTTTTTTTGGTGG + Intergenic
935488251 2:103685253-103685275 CATAACCTTTCCTGATTTGGAGG + Intergenic
937650866 2:124317576-124317598 CAGAATTTTTTTTTTTCTGGAGG + Intronic
939422158 2:141985499-141985521 GAGAATTTTTATTTTTTTGGGGG + Intronic
939585468 2:143999089-143999111 CAGAAACTTTTTTGTTTAGGGGG - Intronic
940943779 2:159593439-159593461 CACTATCCTTTTTGTTTTGGGGG + Intronic
941970837 2:171349411-171349433 CAGTATCTGTCTTTTTGTGGTGG + Intronic
942072494 2:172328501-172328523 CAGAATCTTTCTGTTCTTGCAGG + Intergenic
942393049 2:175516315-175516337 CAGAATCTTTTTGGTTTTTATGG - Intergenic
942759503 2:179382261-179382283 CAGAATTCTTATTGTTGTGGGGG - Intergenic
944799604 2:203226724-203226746 CAGACTTTTTGTTTTTTTGGGGG + Intergenic
944912646 2:204325536-204325558 GAGATTTTTTTTTGTTTTGGAGG + Intergenic
945132956 2:206594717-206594739 GGGTATCTTTCTTGTTTTAGTGG + Exonic
945976058 2:216271716-216271738 AAGAATCTTTCTTCTTGTTGGGG - Intronic
946735251 2:222747560-222747582 CAGGATCTTTTTTACTTTGGTGG - Intergenic
947651406 2:231789429-231789451 AAGCATCTTTATTGTTTTGTGGG + Intronic
1170849469 20:19991423-19991445 CAGGATAATTCTTCTTTTGGGGG + Intronic
1173491949 20:43489918-43489940 CAGAACCTTTTCTGGTTTGGGGG - Intergenic
1173998934 20:47360339-47360361 CAGATACTTCCTTGTTGTGGCGG - Intergenic
1175744286 20:61443261-61443283 CAGAGTCTTCCTTGTTATGCCGG + Intronic
1177079074 21:16616231-16616253 CAGAATCTTTTTTTTTTTGCGGG + Intergenic
1177819750 21:26017907-26017929 CAAGATCTATCTGGTTTTGGGGG - Intronic
1178792459 21:35712895-35712917 CTGAGTCTTTTTTTTTTTGGTGG - Intronic
1178911422 21:36676834-36676856 CAGGATCTTTCCTTTTTTGTTGG + Intergenic
1179651009 21:42808691-42808713 CAGAAGTCCTCTTGTTTTGGGGG - Intergenic
1180560518 22:16611266-16611288 CATCATGTTTCTTTTTTTGGGGG + Intergenic
1180634794 22:17255779-17255801 CAGAATTTTTTTTTTTTTGATGG + Intergenic
1181321992 22:22014662-22014684 CCGATTGTTTTTTGTTTTGGTGG - Intergenic
1181925830 22:26357869-26357891 CAGATTCTTTTTAGTTTTGGTGG - Intronic
1182385143 22:29932409-29932431 CAAAATGTTCCTTTTTTTGGTGG + Intronic
1182683354 22:32100482-32100504 TATAATCTTTATTGTTTTTGAGG + Intronic
1183770357 22:39920003-39920025 CAGAATCTATCTGGTTGTAGTGG + Intronic
1184816535 22:46876101-46876123 CAGAAACTTTGTAGTTTTGTGGG + Intronic
949199602 3:1359057-1359079 CTGTACCTTTTTTGTTTTGGGGG - Intronic
949303503 3:2612437-2612459 CTGAATGTGTATTGTTTTGGGGG + Intronic
950693647 3:14681176-14681198 TATCATCTTTCTTGTTTTGCTGG - Intronic
950745250 3:15082855-15082877 GAGAATGTTTGTTGTGTTGGAGG - Intronic
950859208 3:16132642-16132664 CTGATTCTTTTTTTTTTTGGAGG - Intergenic
953155804 3:40372152-40372174 CAGAATGTTTCCAGTTATGGTGG - Intergenic
953937867 3:47061741-47061763 CAGAAGCTCTCTTGTTATGCTGG - Intronic
954984643 3:54778924-54778946 CAAAATCTTTGTTGGATTGGTGG - Intronic
957707955 3:83814131-83814153 TAGAATTTTTGTTGTTCTGGGGG + Intergenic
958131507 3:89431589-89431611 GAGAATCTTGCTGCTTTTGGTGG - Intronic
959340267 3:105120644-105120666 CCAAACCTTTCTTGTTATGGAGG - Intergenic
959872871 3:111349010-111349032 CTGATTCCTTCTTGTTTGGGTGG - Intronic
960115676 3:113889926-113889948 AAGAAACTTTCTTGTCTGGGTGG - Intronic
960928364 3:122818946-122818968 CACAATATTTTTTTTTTTGGGGG - Intronic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
963502709 3:146147959-146147981 CAGAATCTTTCTTGTTTTGGAGG - Intronic
963610988 3:147468122-147468144 CACTATCTCTCTTTTTTTGGAGG + Intronic
964161665 3:153653347-153653369 CAAAATCTATCTTTTTTAGGTGG + Intergenic
965094839 3:164211829-164211851 CAGAATTTTATTTTTTTTGGGGG - Intergenic
965488087 3:169303226-169303248 AAGGAACTTTCTTGTTTTGTGGG - Intronic
965659899 3:171030018-171030040 CACATGCTTTCTTGTGTTGGAGG + Intergenic
966024119 3:175254535-175254557 GAAAACCTTACTTGTTTTGGAGG - Intronic
966720824 3:183061320-183061342 CAGAACCTTTTTTGTTCAGGGGG - Intronic
967528590 3:190522737-190522759 CAGAATCTTTCATGTGTAGGAGG + Intronic
968052720 3:195666528-195666550 CAAAATCCCTCTTGTTTTAGTGG + Intergenic
968103089 3:195981824-195981846 CAAAATCCCTCTTGTTTTAGTGG - Intergenic
968301403 3:197619404-197619426 CAAAATCTCTCTTGTTTTAGTGG - Intergenic
968740504 4:2328218-2328240 CAGAATCTCTTTTGTTTTTAAGG - Intronic
969842206 4:9890953-9890975 CCGAATCTTCCTTGCTATGGTGG + Intronic
969900762 4:10347070-10347092 CAGAATTTTTTTTTTTTGGGGGG + Intergenic
970501736 4:16684539-16684561 GAGTATATTTCTTGTTTTGTGGG + Intronic
971461838 4:26907724-26907746 CAGAGGCTTTCTATTTTTGGAGG + Intronic
971521571 4:27558303-27558325 CAGAAACTTTCTTTTTTTTCTGG + Intergenic
972221307 4:36958841-36958863 CTGTATTTTTCTTCTTTTGGGGG + Intergenic
973038407 4:45437996-45438018 CAGAATTTTTCTGTTTTTTGAGG + Intergenic
974392435 4:61289604-61289626 CAGAATATTTCTTATTCTGATGG - Intronic
974801163 4:66820054-66820076 CAGAATGTTTCTTTTTTGAGGGG - Intergenic
975143562 4:70942116-70942138 AAGAATCATTCCTGGTTTGGAGG - Intronic
975428147 4:74254583-74254605 CAGCATTTTTTTTTTTTTGGAGG - Intronic
975776480 4:77793016-77793038 CAAGATATTTCTTGTTGTGGGGG - Intronic
976302041 4:83524572-83524594 TAAAAGCTGTCTTGTTTTGGGGG - Intergenic
976604095 4:86966530-86966552 CACAATATTTCTGCTTTTGGGGG - Intronic
977963869 4:103119746-103119768 CTGAATCTGACCTGTTTTGGGGG - Intronic
977967219 4:103167586-103167608 CAGAATTCTTGTTGTTTTGGGGG - Intronic
978987092 4:115026664-115026686 CATCATTTTTCTTTTTTTGGCGG + Intronic
979003102 4:115252439-115252461 CAGAATTTTTATATTTTTGGTGG + Intergenic
979749727 4:124264132-124264154 CATGATCTTTCTTGCTTTGTTGG - Intergenic
979899272 4:126197619-126197641 CAGAATCTTTAGGGTTTTTGAGG + Intergenic
980131811 4:128823493-128823515 CATAATTTTTTTTCTTTTGGAGG + Intronic
980155605 4:129100664-129100686 CAGAATTTTTGTGGATTTGGTGG + Intronic
980335133 4:131463336-131463358 CATAATCTTTTTTCTTTTGGAGG - Intergenic
980431942 4:132712349-132712371 CATAATTTTTCTTGTTTTTAAGG + Intergenic
981994345 4:150959349-150959371 CAAAATCTTTCTTGAATTGTAGG - Intronic
983481077 4:168274753-168274775 CAGAATCTTTCTTATGATGGTGG - Intronic
983620245 4:169753642-169753664 CAGAATCATTCTTGTATTAATGG - Intronic
985325731 4:188767674-188767696 CAGAATAGTTCTTTTTTTAGTGG + Intergenic
985498970 5:228647-228669 CAAAATCTCTCTTGTTTTAGTGG + Intronic
987320988 5:16769063-16769085 CATAATCTTACCTGTTTTGAAGG + Exonic
987605136 5:20124189-20124211 AAGAAACATTTTTGTTTTGGGGG + Intronic
988181142 5:27796202-27796224 CAGAATTGTTGCTGTTTTGGGGG - Intergenic
989495564 5:42107800-42107822 CAGAATTTTTTTTCTTATGGGGG + Intergenic
989937905 5:50053174-50053196 CAGAATCTTCTTTGTGTTGTGGG + Intergenic
990191011 5:53260249-53260271 CATAAGCTTTGTTGTTGTGGAGG - Intergenic
990348901 5:54896264-54896286 CAGAAAGTTTCCAGTTTTGGAGG + Intergenic
990531961 5:56683129-56683151 TAGAATCATTCTTGCTCTGGAGG - Intergenic
993429040 5:87808380-87808402 CAGCATTTTTTTTTTTTTGGTGG + Intergenic
994805485 5:104442131-104442153 CAAAATCTTTCTTGTTTTTCAGG + Intergenic
995310490 5:110704901-110704923 CATAGTATTTCTTGTTCTGGGGG + Intronic
995988233 5:118206845-118206867 CAGAATCTTTCGTTTTTGGTGGG - Intergenic
996655934 5:125936417-125936439 CAGAAACTTTGGTGTTTTGTTGG - Intergenic
998409478 5:141898365-141898387 CACAAGTTTTCCTGTTTTGGGGG + Intergenic
999640041 5:153663190-153663212 CAGAATCTTACTTTTCTTGGAGG - Intronic
999719837 5:154391508-154391530 CAGAATCTTCCTAGTTCTAGTGG + Intronic
999845951 5:155480531-155480553 AAGAATATTTTTTGTTTGGGGGG - Intergenic
1000493130 5:161940670-161940692 CAGAATCTTTTTGGTTTTCTAGG + Intergenic
1002708462 5:181179420-181179442 CAGAATCTTTTCAGTTTTGTCGG - Intergenic
1003180911 6:3790753-3790775 CAGAATCTTTTTTTTTTTTTTGG - Intergenic
1004523325 6:16382636-16382658 CAGCATCTTCATTGTTATGGAGG - Intronic
1004920940 6:20375098-20375120 GAAAATTTTTCTTTTTTTGGGGG + Intergenic
1005692998 6:28325259-28325281 CAGCATTATTCTTCTTTTGGGGG - Exonic
1006834262 6:36987125-36987147 CAGAACCGTGCTAGTTTTGGGGG + Intergenic
1008264462 6:49407369-49407391 CACAGTCTTTCTTGTTTTTTAGG - Intergenic
1009752900 6:67895413-67895435 CATGATCTTTCTAGTTATGGTGG + Intergenic
1010425361 6:75723227-75723249 CAAAATCAATCTTTTTTTGGGGG - Intergenic
1010786345 6:80005002-80005024 GACAGTCTCTCTTGTTTTGGGGG + Intronic
1010950905 6:82035811-82035833 AAGAATCTTTTGTGTTTTGACGG - Intergenic
1011104978 6:83769457-83769479 CAAAATCTGTTTTGTTTTGGGGG + Intergenic
1011312595 6:85996741-85996763 CTGGATAATTCTTGTTTTGGGGG + Intergenic
1011900979 6:92297687-92297709 CATAATATTTCTTATTTTGAAGG + Intergenic
1011945585 6:92898172-92898194 CAGAATATCTCTTCTTATGGAGG + Intergenic
1011948565 6:92936707-92936729 CAAAATCTTTCATGTCCTGGGGG - Intergenic
1011957609 6:93042542-93042564 CAAAATCTTTTTTGTTATGTGGG - Intergenic
1012072344 6:94639274-94639296 CAAAATCTTTATAGTTTGGGAGG + Intergenic
1012298463 6:97554215-97554237 CAGATTTTTCCTTCTTTTGGTGG - Intergenic
1012802190 6:103844642-103844664 CTGAAACTATCTTGTTTTGAAGG + Intergenic
1014222673 6:118814109-118814131 CAGATTCTTTTTTCTCTTGGGGG - Exonic
1014437881 6:121440664-121440686 CAGTATCTTTCTATTTTTTGTGG + Intronic
1015893264 6:137990270-137990292 CAGTATCTTTTTTCTTTTTGAGG - Intergenic
1017567400 6:155702191-155702213 CAGAGTCTTTGGTGTTTTGTAGG + Intergenic
1017656910 6:156638520-156638542 CAGAATCTTCCTCCTTTTTGAGG - Intergenic
1017681153 6:156865204-156865226 CTGTGTCTTTCTTGTTTTGGTGG + Intronic
1017767815 6:157621319-157621341 CAAAATTTTTCTAATTTTGGAGG + Intronic
1018422294 6:163650001-163650023 CAATATCGTCCTTGTTTTGGTGG - Intergenic
1020849175 7:13328337-13328359 CAGAACTTTACTTTTTTTGGAGG - Intergenic
1023636046 7:42211662-42211684 CAGAATATTTTTTGTTTTAGTGG - Intronic
1023765684 7:43508379-43508401 CTGAATCTTTCCTTTTTAGGTGG + Intronic
1024809071 7:53185754-53185776 CAGCATCTTTGTAATTTTGGTGG - Intergenic
1026207048 7:68266951-68266973 CAGAGTCTTGCTTGTGTTGAAGG - Intergenic
1026302233 7:69108050-69108072 CAGATTTTTTTTTTTTTTGGTGG - Intergenic
1027390510 7:77698651-77698673 TAGAATCCTTCTTCTTTTGAGGG + Intronic
1028574289 7:92329528-92329550 CATAATCTTTATTGTTTAGGTGG - Intronic
1029214420 7:98936258-98936280 CAGAATCTTTCTTGAGTTAGAGG + Intronic
1030253682 7:107482135-107482157 AAAAATCTTTTTTTTTTTGGTGG + Intronic
1031562632 7:123256419-123256441 GAGAAAATTTTTTGTTTTGGGGG + Intergenic
1032321691 7:130891583-130891605 CAGAATGTTTCTTTTTTGGCAGG - Intergenic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1032895026 7:136240818-136240840 CAGAATCTTGACTGTTTTGGAGG + Intergenic
1032916870 7:136500777-136500799 CAGAATCTATCCTGATTGGGAGG + Intergenic
1033202195 7:139382928-139382950 AAGTATCTTTTTTTTTTTGGAGG + Intronic
1033216185 7:139495303-139495325 GAAAATCTCTCTTTTTTTGGGGG + Intergenic
1033561200 7:142533276-142533298 CCAAATCTTTCTTTTTTGGGGGG + Intergenic
1033882606 7:145903701-145903723 CATTATCTTTCTAGTTTTTGAGG + Intergenic
1034424147 7:151005510-151005532 CAAAATCTTTCCTGTTTTAGTGG - Intronic
1034662401 7:152783606-152783628 AAGATTCTTTTTTTTTTTGGTGG + Intronic
1037162869 8:15793987-15794009 CTGACTCTTTCTTCTTTAGGAGG - Intergenic
1037273353 8:17153876-17153898 AGGAATCTCTCTTTTTTTGGGGG - Intergenic
1037384949 8:18328889-18328911 CAGAAGTTTGCTGGTTTTGGAGG - Intergenic
1037661181 8:20928107-20928129 CAGAATTTTACCTGCTTTGGTGG + Intergenic
1037984205 8:23276704-23276726 CAGAATATTTGTGTTTTTGGTGG - Intronic
1038499270 8:28029952-28029974 CAGGCTCTTTCCTGTTTTGGTGG - Intronic
1038509008 8:28113280-28113302 CATAATCTTTCTTGTTTCATGGG + Intronic
1038650650 8:29400179-29400201 CTGAATGTTTCTTTCTTTGGAGG + Intergenic
1039304966 8:36251582-36251604 CAGCATTTTTTTTGTTTTGAAGG + Intergenic
1039682106 8:39751779-39751801 CAGAAACCTTCTTGTTATGTAGG + Intronic
1040497185 8:47976571-47976593 CAGAATCTTTCTCTTTTTGGTGG - Intronic
1040910933 8:52518057-52518079 CAGATACTTTTTTGCTTTGGAGG + Intergenic
1041122177 8:54597932-54597954 CTGCATCTTTCTTGTGGTGGTGG - Intergenic
1041246406 8:55892542-55892564 AAGTATCTTTCTTTTTTTTGAGG + Intronic
1041967345 8:63694518-63694540 ATCAATCTTTTTTGTTTTGGGGG - Intergenic
1042783146 8:72514198-72514220 CATAATTTTTTTTGTTGTGGTGG - Intergenic
1043115457 8:76247596-76247618 CAGAATTTTTTTTTTTTTAGTGG + Intergenic
1043191125 8:77224713-77224735 CTGATTCTTTCTCGTTTTTGTGG + Intergenic
1043496602 8:80807891-80807913 AAGCATCTTTCTAGTTTTGAAGG + Intronic
1043512986 8:80967687-80967709 CATTATCTTTCCTGTTATGGTGG + Intergenic
1043656678 8:82675367-82675389 CTGAATCTTTCTCATTTTTGTGG - Intergenic
1043971051 8:86528912-86528934 AAGAAACTTTTTTGTTTTTGCGG + Intronic
1044098960 8:88105677-88105699 CAAAATCATTCTTGTTTTCAAGG + Intronic
1044862881 8:96540505-96540527 CAGATTTTTTTTTTTTTTGGAGG - Intronic
1046028283 8:108751204-108751226 AAGAATCTTTTTTGTTGGGGAGG - Intronic
1046409181 8:113816952-113816974 CAGAATCTTTTTTGTTTCTGTGG + Intergenic
1046508899 8:115173137-115173159 CAGAATCCCCCTTTTTTTGGCGG + Intergenic
1047106521 8:121737120-121737142 CAGACTATTTCTTGAGTTGGGGG - Intergenic
1047726008 8:127684534-127684556 AAGAATCCTTCTTTCTTTGGAGG + Intergenic
1048524653 8:135190984-135191006 CAAAATCTTTCTCTTTGTGGAGG - Intergenic
1052595853 9:30557691-30557713 CAGAATCATTCTTCCTTTAGGGG + Intergenic
1052689332 9:31796946-31796968 CAGAATCTTTCTCTTTTTAAAGG - Intergenic
1055203769 9:73701199-73701221 CAGTATTTTTATTGTTTTTGTGG - Intergenic
1056894323 9:90528010-90528032 CAGAGTCTTTAGTGTTTTGTAGG - Intergenic
1058239417 9:102538169-102538191 CAGAATTTTTTTTTTTTTGGTGG - Intergenic
1059184473 9:112255034-112255056 CAGAATTTTTCTCCTTTTTGAGG - Intronic
1059491617 9:114672350-114672372 AAGGATCTTTCTAGTTTTGAAGG + Intergenic
1059815402 9:117907206-117907228 CTGTCTCTTTCTTTTTTTGGAGG + Intergenic
1060181416 9:121537031-121537053 AAGAATTTTTTTTTTTTTGGTGG + Intergenic
1186358577 X:8813787-8813809 CAGGCTCTGTCCTGTTTTGGGGG + Intergenic
1186504477 X:10080197-10080219 CTGGATCATTCTTGTCTTGGGGG + Intronic
1186811012 X:13188413-13188435 CAGATACTTTTTTCTTTTGGGGG - Intergenic
1186941768 X:14516693-14516715 CAGCATCTTCCTTGTTTTTTTGG + Intergenic
1187429158 X:19205870-19205892 CAGAATCTACCTTGTTCAGGAGG + Intergenic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1188831264 X:34900407-34900429 CAGTAGCTTTATTATTTTGGGGG - Intergenic
1189200565 X:39192319-39192341 CAGAATAGTGGTTGTTTTGGTGG - Intergenic
1190438687 X:50454102-50454124 CAGAATTTTTCTTATTTGGGTGG - Intronic
1190648369 X:52544223-52544245 CAGAATCTGTCCTCTGTTGGGGG - Intergenic
1191274639 X:58527780-58527802 CAGAAACTTCTTTGTTATGGGGG + Intergenic
1191779680 X:64852044-64852066 CAGAATCTCTTTTTTTTTGGAGG + Intergenic
1191993894 X:67069010-67069032 CTGATTCTTTCTTGTTTTGTGGG - Intergenic
1192254708 X:69446078-69446100 CAGTATCTTTGTTTTTTTGGGGG + Intergenic
1192302111 X:69915876-69915898 CAGAATCTGTCTTAATCTGGAGG - Intronic
1192373758 X:70538180-70538202 AAAACTCTGTCTTGTTTTGGGGG + Intronic
1194261980 X:91706923-91706945 CAGAATTTTATTTGTTTTTGTGG - Intergenic
1196420033 X:115511834-115511856 CAGAGTCTGTGTTGTTATGGTGG + Intergenic
1196516724 X:116622064-116622086 GAGAATCTTTCTTATTTCTGTGG + Intergenic
1197388086 X:125826040-125826062 CAGAATCTTTCTCATTCAGGAGG + Intergenic
1197503578 X:127273238-127273260 CAATGTCTTTCTTTTTTTGGCGG - Intergenic
1198497392 X:137206114-137206136 CAGTTTTTTTCTTTTTTTGGAGG - Intergenic
1198847871 X:140931991-140932013 CAGAATCATTCTTGTTAGGTTGG - Intergenic
1198972683 X:142298817-142298839 CTGTAACTTTTTTGTTTTGGGGG + Intergenic
1199218347 X:145287323-145287345 CAGGATTTTTTTTTTTTTGGTGG + Intergenic
1199664467 X:150085640-150085662 TAGAATCATTCTTTTTTTGGTGG + Intergenic
1201449261 Y:14093092-14093114 AAGAATATTTATTGTTTTGACGG + Intergenic