ID: 963505601

View in Genome Browser
Species Human (GRCh38)
Location 3:146180931-146180953
Sequence TTTGTTACACACACACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963505598_963505601 5 Left 963505598 3:146180903-146180925 CCACAACTAAAGTCCTGACAAAG No data
Right 963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG No data
963505599_963505601 -8 Left 963505599 3:146180916-146180938 CCTGACAAAGAATATTTTGTTAC No data
Right 963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG No data
963505597_963505601 16 Left 963505597 3:146180892-146180914 CCAGGCTCTCACCACAACTAAAG No data
Right 963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963505601 Original CRISPR TTTGTTACACACACACATGA GGG Intergenic
No off target data available for this crispr