ID: 963506762

View in Genome Browser
Species Human (GRCh38)
Location 3:146195716-146195738
Sequence AACTGAAGCTCGTTGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963506762_963506768 9 Left 963506762 3:146195716-146195738 CCAGATACCAACGAGCTTCAGTT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 963506768 3:146195748-146195770 GGAAACCTGGCACTTGTCACAGG 0: 1
1: 0
2: 2
3: 18
4: 142
963506762_963506769 10 Left 963506762 3:146195716-146195738 CCAGATACCAACGAGCTTCAGTT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 963506769 3:146195749-146195771 GAAACCTGGCACTTGTCACAGGG 0: 1
1: 0
2: 0
3: 11
4: 156
963506762_963506767 -4 Left 963506762 3:146195716-146195738 CCAGATACCAACGAGCTTCAGTT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 963506767 3:146195735-146195757 AGTTTCTAAAAGGGGAAACCTGG 0: 1
1: 0
2: 0
3: 23
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963506762 Original CRISPR AACTGAAGCTCGTTGGTATC TGG (reversed) Intronic
919643558 1:200068729-200068751 AGCTGAAGCTCATTAGTTTCAGG + Intronic
1062935416 10:1382506-1382528 AACAGAAGTTCTTTGGCATCAGG + Intronic
1071545424 10:86525264-86525286 AATTGAAGCAGGCTGGTATCTGG - Intergenic
1086543766 11:87944328-87944350 AAATGAAGCACGTTTGTATTTGG + Intergenic
1092126177 12:6076672-6076694 AACTGGAGCCAGTTGGTATTTGG + Intronic
1099513723 12:83569773-83569795 AAATGAAGCTCATTTCTATCGGG - Intergenic
1101089995 12:101275460-101275482 AATAGAAGCTCTGTGGTATCAGG + Intergenic
1101477140 12:105061564-105061586 AACTGAAGCATGTTCGTAACTGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1102815760 12:115864825-115864847 AACTGAAGCTGGATAGGATCAGG + Intergenic
1104725367 12:131072334-131072356 AACTGAAGCTTCTTGGTCTTTGG + Intronic
1114683754 14:24508166-24508188 AGCTGAAGCTGGTGAGTATCAGG - Exonic
1123499991 15:20872371-20872393 AACTGAACATCTTTGGCATCTGG + Intergenic
1123557239 15:21446068-21446090 AACTGAACATCTTTGGCATCTGG + Intergenic
1123593464 15:21883336-21883358 AACTGAACATCTTTGGCATCTGG + Intergenic
1202965585 15_KI270727v1_random:173256-173278 AACTGAACATCTTTGGCATCTGG + Intergenic
1143332304 17:6146746-6146768 AACTGAAGCTTGGTGGTAGTGGG - Intergenic
1149775944 17:59357254-59357276 AACTAAAACTAGTTGGTGTCAGG - Intronic
1154458594 18:14555322-14555344 AACTGAACATCTTTGGCATCTGG + Intergenic
930198519 2:48530876-48530898 AACTGAACCTCGTGGGTACAGGG + Intronic
932188166 2:69716273-69716295 AACTGAAGCTAGTTTGTGTTGGG + Intronic
944200189 2:197098726-197098748 TAGTAAAGCTCTTTGGTATCTGG - Intronic
947654120 2:231811533-231811555 AACTGGAACACTTTGGTATCAGG - Intergenic
1171387203 20:24778509-24778531 AACTGAAGCTCCTTGGAGCCAGG + Intergenic
1173948125 20:46967917-46967939 AACAGAAGCTCGATCTTATCTGG + Intronic
1176815555 21:13598018-13598040 AACTGAACATCTTTGGCATCTGG - Intergenic
1177869585 21:26555033-26555055 AACTGAGGCTCGGTGATATTAGG + Intronic
1178073192 21:28992176-28992198 AACTGAAGAGCGTTGGGAGCCGG + Intronic
1178320747 21:31603527-31603549 ACTTGGAGCTGGTTGGTATCAGG + Intergenic
1182583615 22:31329915-31329937 AACTGAAGCTTTTTAGTATAAGG + Intronic
954343548 3:49975522-49975544 AACTAAAGCTGGTTGTTATTTGG - Intronic
957252156 3:77786633-77786655 AACTGAACATCTTTGGCATCTGG + Intergenic
961003110 3:123387231-123387253 ATCTGAAAATCATTGGTATCAGG + Intronic
963506762 3:146195716-146195738 AACTGAAGCTCGTTGGTATCTGG - Intronic
964869270 3:161295392-161295414 AACTGATGCTGGTTGGTGGCTGG + Intergenic
970071064 4:12161124-12161146 ATCTGATGCTCTTTGGTGTCTGG + Intergenic
972830154 4:42805630-42805652 AACAGTAGTTTGTTGGTATCTGG - Intergenic
977984914 4:103371911-103371933 AACTAAAGCTCCTTGGCATGTGG - Intergenic
980668832 4:135975697-135975719 TGCTAAAGTTCGTTGGTATCTGG + Intergenic
984743129 4:183186805-183186827 AACTAATTCTCGTTGGTACCAGG + Intronic
989204923 5:38800824-38800846 AACTCAAGCTCTTTGGCCTCTGG + Intergenic
993317755 5:86432673-86432695 AACTGAAGCTCAGAGGTATTTGG + Intergenic
996162666 5:120184770-120184792 AACTGAAGGTCTTTAATATCTGG + Intergenic
999875935 5:155805758-155805780 GCCTGAAGCTCTTTGATATCTGG - Intergenic
1006893589 6:37451272-37451294 AACTCAATCTCTTTGGTCTCAGG - Intronic
1007990713 6:46252451-46252473 ATCTCAAGCTCTTTGGTTTCAGG + Intronic
1010702308 6:79065007-79065029 AAATGCAGCTCCTTGGTTTCTGG - Intronic
1030918176 7:115343792-115343814 AACTGATGCTCATGGGGATCAGG + Intergenic
1036828027 8:11994205-11994227 AACCAAATCTCCTTGGTATCCGG - Intronic
1042577810 8:70240148-70240170 CACTGAAGCTTGTTATTATCTGG - Intronic
1058620132 9:106874178-106874200 AACTGAAGCGTGTTGTTCTCTGG + Intronic
1061342728 9:129996105-129996127 AACTGTAGCTCTTTCTTATCTGG - Intronic
1062184303 9:135209318-135209340 AACTGGTGCTTGTTGGAATCAGG + Intergenic
1062704769 9:137931776-137931798 ATCTGAAGCTTGATGGTCTCTGG + Intronic
1203531804 Un_GL000213v1:151443-151465 AACTGAACATCTTTGGCATCTGG + Intergenic
1188103215 X:26116505-26116527 AGCTGAAGCTGGCTGGAATCTGG - Intergenic
1194198435 X:90925612-90925634 AAGTGAAGCTTTTGGGTATCCGG + Intergenic
1200543304 Y:4487216-4487238 AACTGAAGCTTTTGGGTATCCGG - Intergenic