ID: 963507046

View in Genome Browser
Species Human (GRCh38)
Location 3:146199383-146199405
Sequence ACCTTGCCACAGATAAAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963507046_963507048 -8 Left 963507046 3:146199383-146199405 CCACTCTTTATCTGTGGCAAGGT 0: 1
1: 0
2: 3
3: 13
4: 121
Right 963507048 3:146199398-146199420 GGCAAGGTATGCGTTGTGATGGG 0: 1
1: 0
2: 0
3: 10
4: 44
963507046_963507047 -9 Left 963507046 3:146199383-146199405 CCACTCTTTATCTGTGGCAAGGT 0: 1
1: 0
2: 3
3: 13
4: 121
Right 963507047 3:146199397-146199419 TGGCAAGGTATGCGTTGTGATGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963507046 Original CRISPR ACCTTGCCACAGATAAAGAG TGG (reversed) Intronic
901866116 1:12107986-12108008 ACCATGCCACAGAACACGAGAGG + Intronic
903035861 1:20492133-20492155 GCCTAGCCACAGAAACAGAGTGG + Intergenic
904017589 1:27434730-27434752 AACTTGCTACAGATGAAGATGGG - Intronic
906457132 1:46006776-46006798 ACCTTTAAACAGAAAAAGAGAGG - Intronic
910457240 1:87411070-87411092 ACCTTGCCACACACAACAAGTGG + Intergenic
911204062 1:95075114-95075136 ACCGTGCCACAGAGCAAGACTGG - Intergenic
915912286 1:159922707-159922729 ACCATGGCACAGGTAAAGAAAGG + Intronic
916345122 1:163780286-163780308 ATGTTGCCAGAAATAAAGAGGGG + Intergenic
919525743 1:198647950-198647972 ACCTTGCTACAGATAATTATTGG + Intronic
919540495 1:198839385-198839407 ACTTTTACACAGAGAAAGAGAGG - Intergenic
919635018 1:199995656-199995678 ACCTTGCCCCAAATTAAGACTGG + Intergenic
923558780 1:235022659-235022681 AGCTGGCCACAGAGAGAGAGAGG + Intergenic
924459797 1:244248842-244248864 CCCTTTTCACAGATAAAGGGAGG + Intergenic
1063396211 10:5690496-5690518 TCCTGGGCACAGATAAATAGGGG - Intronic
1063754080 10:8985868-8985890 ACCTTGGCCCAGAGCAAGAGTGG - Intergenic
1065697982 10:28397922-28397944 ACCTTGCCTCAAAAAAAAAGTGG - Intergenic
1067251846 10:44593292-44593314 ACCTTGGCACAGTTCAGGAGAGG + Intergenic
1070306746 10:75244209-75244231 TCCTGGCCACAGATAAAGGGGGG + Intergenic
1071261438 10:83923008-83923030 ATCCCACCACAGATAAAGAGAGG - Intergenic
1075659521 10:124183668-124183690 ACCCTGTCATAGAAAAAGAGTGG - Intergenic
1076431433 10:130405896-130405918 ATGTTGCCAGGGATAAAGAGGGG + Intergenic
1079467742 11:20748016-20748038 CCCTTGCCATAGCTAAAGAGGGG + Intronic
1082201354 11:49373559-49373581 AGCTTGTCACAGATAAAGAGTGG + Intergenic
1086654318 11:89332678-89332700 AGCTTGTCACAGATAAAGAGTGG - Intronic
1087511979 11:99107232-99107254 ACATTGGCACAGAAAAATAGTGG + Intronic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1089695264 11:120212499-120212521 TCCTTCCCCCAGCTAAAGAGAGG + Intronic
1090532471 11:127605267-127605289 ACCCTGCCACACAAAAAAAGGGG - Intergenic
1090823273 11:130364209-130364231 ACCTTGCTACAGAAAAAGAAAGG + Intergenic
1090902456 11:131044957-131044979 ACCTAGTCTCACATAAAGAGAGG + Intergenic
1091204807 11:133812857-133812879 AAGTTGCCACAGATGAAGTGAGG + Intergenic
1093609682 12:21138242-21138264 AGCTTGACACAGATAAGTAGAGG + Intronic
1096052885 12:48626944-48626966 ACCTGTCCAAAGAGAAAGAGTGG + Intergenic
1099768216 12:87018201-87018223 ACATTGGCAGATATAAAGAGAGG + Intergenic
1100743800 12:97623642-97623664 ACATTGCCTCACATAAAGAAGGG + Intergenic
1102376458 12:112425734-112425756 ACCTTGTCTCAAAAAAAGAGAGG - Intronic
1108427581 13:50319367-50319389 ACTTTTCCACAGACACAGAGTGG - Intronic
1111850318 13:93565196-93565218 CCCTTTCAACAGATAAAGGGAGG - Intronic
1112265482 13:97919709-97919731 ATTTTGCCACAGAAAAGGAGAGG - Intergenic
1113580279 13:111423776-111423798 ATCTTTCCCCAGATACAGAGTGG - Intergenic
1114491843 14:23107365-23107387 ACATTTCTACAGATAAAAAGTGG - Intergenic
1121754163 14:96389453-96389475 AGCTTGCCACAGTTACAGGGGGG - Intergenic
1126405190 15:48316013-48316035 ACCTTGTCACAGGTAAACAAAGG - Intergenic
1129469121 15:75740585-75740607 ACATTGCCACAGTGAAATAGGGG + Intergenic
1129956321 15:79639971-79639993 CCCATACCACAGATAAGGAGGGG + Intergenic
1130879795 15:88045152-88045174 TCCTTGCCACAGACACAGGGTGG - Intronic
1134016024 16:10889051-10889073 TCATTGCCACGGATGAAGAGAGG + Intronic
1134596266 16:15498514-15498536 ACCTTGTTTCAGATAAAAAGAGG + Intronic
1138197484 16:55062138-55062160 CCCATGCCACAGATAATAAGTGG + Intergenic
1140122120 16:72093007-72093029 ACCCCGCCTCAGAAAAAGAGAGG - Intronic
1147321422 17:39648506-39648528 ACTTTCCCCCAGATAAACAGAGG + Intronic
1151637198 17:75358434-75358456 AGCATGCCACAGATAAATAATGG - Intronic
1154000643 18:10479466-10479488 ACCTTTCCAGAAATAAACAGTGG + Intronic
1165093521 19:33398421-33398443 ACCTTGGCACAGCTACAGAGTGG + Intronic
1168668053 19:58219161-58219183 ACCTTGTCTCAAAAAAAGAGGGG + Intergenic
925029678 2:639994-640016 ACCAAGCCACAGAAAAACAGTGG + Intergenic
925841891 2:7999821-7999843 AGCTTGTCACAGATAGAGCGTGG + Intergenic
927544299 2:23939730-23939752 ACCTTGTCACAGCTAACGACGGG + Intronic
929494077 2:42424304-42424326 ACCTTGCCACAGATTTACAGGGG + Intronic
932394073 2:71427268-71427290 ACCATCCCACAGATAAAAAAGGG + Exonic
934649164 2:96079825-96079847 AAGTTACCAGAGATAAAGAGGGG - Intergenic
935115688 2:100134065-100134087 ACATTTCCAAAGATAGAGAGTGG - Intronic
936983909 2:118290088-118290110 AGCTTGCCACTGGTAAGGAGAGG + Intergenic
939815553 2:146892228-146892250 ACTTTACCACAAATCAAGAGCGG - Intergenic
948676580 2:239600576-239600598 GACTTGCCACAGAGAAAGAAAGG + Intergenic
1168810137 20:699756-699778 CCCTTGCCACAATTAAGGAGGGG - Intergenic
1175720430 20:61282516-61282538 ACCATGCCAAAGATTAAAAGTGG - Intronic
1181175424 22:21032283-21032305 ACCTGGCCACAGACAGACAGTGG + Intronic
1181369538 22:22405151-22405173 ACCTGGCCACAGCTACAGTGAGG - Intergenic
1182170082 22:28219661-28219683 ACCTAACCAAAGATCAAGAGAGG + Intronic
1182551616 22:31103881-31103903 ACCTATCCATAGATAAAGATTGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
951391396 3:22108585-22108607 ACTTTGCCACTGACTAAGAGAGG + Intronic
952844158 3:37672724-37672746 AACTTGCCCCAGATAAACATAGG - Intronic
956738149 3:72255006-72255028 ACCTTCCCATAGAGCAAGAGAGG - Intergenic
962627581 3:137241789-137241811 ACCTTGAGAGAGATAAAGAGAGG - Intergenic
963507046 3:146199383-146199405 ACCTTGCCACAGATAAAGAGTGG - Intronic
971242214 4:24899147-24899169 ATCTGGCCACAGTGAAAGAGTGG + Intronic
977563436 4:98557310-98557332 ATCATGACACAGAAAAAGAGAGG + Intronic
977853748 4:101861977-101861999 CACTTACCACAAATAAAGAGTGG + Intronic
977964848 4:103133549-103133571 ACCTGGCCAGACATAAAGACTGG - Intronic
980198987 4:129629817-129629839 ACCCTGCTACAGATATAAAGAGG - Intergenic
981848803 4:149203092-149203114 ACCTTGCCTCTGATAATGATTGG + Intergenic
983294055 4:165843128-165843150 ACCTTTACACAAATAAAAAGAGG - Intergenic
983489583 4:168372717-168372739 ACCCTGTCACAAATAAAAAGTGG + Intronic
986826574 5:11528850-11528872 ACCTGGCCACTGATGAAAAGGGG - Intronic
987620618 5:20335190-20335212 ACCTTGCTACAGAGAAATAAGGG - Intronic
990499637 5:56383032-56383054 AACTTACCAGAGATAAAGAGGGG + Intergenic
993824532 5:92666267-92666289 AGCTTGCCTAAAATAAAGAGTGG + Intergenic
996018315 5:118565750-118565772 ACTTAGCCACAGAGAAAGATGGG + Intergenic
997847295 5:137298743-137298765 ATATTAACACAGATAAAGAGAGG - Intronic
998437927 5:142129217-142129239 ACCTTCCCACAGCACAAGAGTGG + Intronic
1003834798 6:10059209-10059231 ACCTGGGCACAGACAAGGAGGGG - Intronic
1005631362 6:27711219-27711241 GCATTGTCACAGGTAAAGAGAGG + Intergenic
1007403995 6:41623032-41623054 ACCTTGCCTCAGAGAAAGAGAGG + Intergenic
1008168651 6:48173763-48173785 ACGTTACCACAGAGACAGAGAGG - Intergenic
1009521274 6:64685162-64685184 ACATTACCAGAGATAAAGAAGGG + Intronic
1010474024 6:76263889-76263911 ACCTAGGCACAGAAAAAGTGTGG + Intergenic
1011007786 6:82667203-82667225 TCCTTGACCCAGAAAAAGAGTGG + Intergenic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014912987 6:127116471-127116493 ACTTTGCAACAGATAAAGGATGG + Intergenic
1015916085 6:138218531-138218553 ACATTGGCTCAGCTAAAGAGTGG - Intronic
1016761309 6:147740539-147740561 ACCGTGCCACAGACAGGGAGTGG - Intergenic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1017904190 6:158745025-158745047 ACTTTGCCACAGCTAATGAGTGG + Intronic
1018233043 6:161694483-161694505 ACCTTTGCCCAAATAAAGAGGGG - Intronic
1018886158 6:167939850-167939872 ACATTGTCACAGATAGAGTGAGG + Intronic
1029710094 7:102294756-102294778 ACCTGGCTACAGATGGAGAGAGG - Intronic
1030225408 7:107144826-107144848 ACCCTAACACAGACAAAGAGTGG - Intronic
1030477656 7:110057966-110057988 ATGTTACTACAGATAAAGAGAGG + Intergenic
1031233182 7:119136614-119136636 GATTTGACACAGATAAAGAGGGG - Intergenic
1033835943 7:145312405-145312427 ACTTGGACACACATAAAGAGTGG + Intergenic
1033922506 7:146411701-146411723 AAATTGCCACATATAAAGGGTGG + Intronic
1034602717 7:152277575-152277597 ACATTGTTACAGATCAAGAGTGG - Intronic
1034962497 7:155371744-155371766 GCCTTGCAACAGGGAAAGAGGGG - Intergenic
1037479573 8:19291928-19291950 TACTTGCCAAAGATTAAGAGTGG - Intergenic
1039548203 8:38424736-38424758 ACCTTGCCATGGCTAAAGAGGGG + Intronic
1043005942 8:74818738-74818760 GCATGGCCCCAGATAAAGAGGGG - Intronic
1043206785 8:77454230-77454252 TCCTTTTCACAGATAGAGAGAGG + Intergenic
1045342800 8:101269406-101269428 GCCTGGCCAAAGATAAAGTGGGG - Intergenic
1046547528 8:115669534-115669556 TTCTTGCCACAGATAAAGGGCGG - Intronic
1047688528 8:127326411-127326433 ACATTGCCAGGGATAAAGAGGGG + Intergenic
1047875636 8:129134431-129134453 AGCTGGACACAGATAAAGACAGG + Intergenic
1048559428 8:135517343-135517365 ACTTTGCCACAGTTAACTAGAGG + Intronic
1050338689 9:4614415-4614437 AACTGGACACAGAGAAAGAGTGG + Intronic
1052392434 9:27896099-27896121 TCCTTGCAACAGAAAAACAGAGG + Intergenic
1052747864 9:32458440-32458462 ACCTTGCTACAGAAAAACAAAGG - Intronic
1053031796 9:34786642-34786664 ACATTTCCACATATAAATAGAGG + Intergenic
1057544147 9:96004547-96004569 ACATTGCCACACACAAAGAAAGG + Intronic
1057597134 9:96424087-96424109 ACCTTTCCACAGATGGAGAGAGG - Intergenic
1057835441 9:98440912-98440934 ACCTTGACACACACACAGAGAGG + Intronic
1059382932 9:113942422-113942444 ACTTTGCCATAGAGAAAGAGCGG + Intronic
1059394586 9:114026370-114026392 TCCCTGCCACAGGGAAAGAGGGG + Intronic
1061045257 9:128161492-128161514 CCCTTGACACAGATAAAGCCTGG + Intronic
1062074796 9:134579953-134579975 AGATTGCCAGAGATTAAGAGGGG + Intergenic
1189203787 X:39220398-39220420 ACTTCCCCACAGAAAAAGAGAGG - Intergenic
1193587079 X:83337377-83337399 ACATACCCACAAATAAAGAGAGG + Intergenic
1196134400 X:112191436-112191458 ACAAAGCCACAGATACAGAGTGG - Intergenic