ID: 963508747

View in Genome Browser
Species Human (GRCh38)
Location 3:146221705-146221727
Sequence GCAAGGTCCTGCCTTGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963508747 Original CRISPR GCAAGGTCCTGCCTTGGTAG AGG (reversed) Intronic
902743184 1:18454705-18454727 GCATGGACCAGCCTTGGTTGGGG - Intergenic
903013305 1:20345466-20345488 GCAAGGCGCTCACTTGGTAGCGG - Exonic
903066355 1:20701822-20701844 GACAGGGCCTGCCTGGGTAGGGG + Intronic
903585043 1:24408209-24408231 GAAATGTCATGCCTTAGTAGTGG - Intronic
905517391 1:38571927-38571949 ACCAGCTCCTGCCTTGGCAGAGG - Intergenic
907308737 1:53527667-53527689 GCAAGGCCCTGCCCTGTGAGGGG + Intronic
908745834 1:67375670-67375692 TGAAGGACCTGCCTTGGCAGAGG + Intronic
910368589 1:86492314-86492336 GCAAGGGCCTGCTTTGGAAAAGG + Intronic
910697111 1:90031078-90031100 GGAAACTCCTGCCTTGATAGGGG - Intronic
912180931 1:107218634-107218656 TCATGGTGCTGGCTTGGTAGTGG + Intronic
912223524 1:107704749-107704771 TCAAGGTACCCCCTTGGTAGAGG + Intronic
912742024 1:112207143-112207165 GAAAGGTCCTGCCTTAATAATGG + Intergenic
913312657 1:117517082-117517104 GGAAGGTCCTGCCTCAATAGTGG + Intronic
917380583 1:174401925-174401947 GAAAGGTCCTGCCATGGTCAGGG + Intronic
923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG + Intronic
1065979651 10:30879256-30879278 GAAGGGTCTTGCCTTAGTAGGGG + Intronic
1071450850 10:85790515-85790537 GGAAGGTCCTGTCTGGGCAGAGG + Intronic
1073352664 10:102831037-102831059 GCATGGTTCTGCCCTGGTTGAGG + Intronic
1077083028 11:733896-733918 GGAATGTCCCGCCTTGGTCGTGG - Intergenic
1084617505 11:70246357-70246379 GCAAGTTCCTGCCTGGCCAGTGG + Intergenic
1085844351 11:80048674-80048696 GAAAGGCCCTGGCTTAGTAGTGG + Intergenic
1090023881 11:123151166-123151188 CCATGGCCCTGCCCTGGTAGTGG - Intronic
1091705083 12:2688383-2688405 GCAGGGGCCTGCCTTGTTTGGGG + Intronic
1093710084 12:22320415-22320437 GGAAGGAGCTGCCTTGGGAGTGG + Intronic
1095981004 12:47974824-47974846 CCAAGGTGCAGCCTTGGTTGGGG + Exonic
1099315605 12:81078675-81078697 GCAAGGTTCTGCTTTGGCAGTGG + Intronic
1104635110 12:130433605-130433627 GCCAGTTCCTGCCTGGGTGGTGG + Intronic
1110465497 13:75795875-75795897 GCCAGGTGATGCCTTGATAGGGG + Intronic
1115786575 14:36833336-36833358 GCAAGGTGCTCCCTGGGTAGAGG + Intronic
1118833572 14:69458598-69458620 TCAAGGTCCAGCCTTGGTCCAGG + Exonic
1120181050 14:81342709-81342731 GCCAGGGTCTGCCTAGGTAGAGG + Intronic
1122555558 14:102577559-102577581 ACAAGGCACTGCCCTGGTAGGGG - Intergenic
1123066402 14:105621580-105621602 GCGAGGTCCTGCCTGAGTGGGGG + Intergenic
1123070541 14:105640632-105640654 GCGAGGTCCTGCCTGAGTGGGGG + Intergenic
1123075136 14:105664292-105664314 GCGAGGTCCTGCCTGGGTGGGGG + Intergenic
1123089783 14:105737420-105737442 GCGAGGTCCTGCCTGGGTGGGGG + Intergenic
1123095573 14:105765580-105765602 GCCAGCTCCTGCCTGGGTGGGGG + Intergenic
1127539658 15:59924323-59924345 GCAAGCTCCTGCCGTGTTAAGGG - Intergenic
1127840652 15:62828624-62828646 GCAAGTTCCTGCCCTGTTTGAGG - Intronic
1128392253 15:67190222-67190244 TCAAAGTCCTCCCTGGGTAGAGG + Intronic
1135262773 16:20995723-20995745 ATAGGGTCCTGCCTTGGAAGGGG + Intronic
1143016179 17:3892441-3892463 GCAGGGTCCTGCCTTGGCTGGGG - Intronic
1146059860 17:29598947-29598969 GCCAGGTGCTGCCTGGGGAGTGG + Intronic
1147703641 17:42411516-42411538 GCCAGATCCTGCCTTGGGTGGGG - Intronic
1148862433 17:50611620-50611642 GCAAATTCCTGACTTGTTAGGGG + Intronic
1152229494 17:79107349-79107371 GCCACGCCCTGCCTTGGGAGAGG - Intronic
1155168109 18:23247443-23247465 GCCAGATCCTGGCTTGGAAGGGG - Intronic
1160017228 18:75154211-75154233 GCAAGCTCCTGCCCTTGCAGAGG - Intergenic
1164435368 19:28224117-28224139 GCAAGGTCCATCCTTGTAAGGGG + Intergenic
1164849420 19:31469127-31469149 GCAGGGTCCTGCCTTGATGGGGG + Intergenic
1166736046 19:45085587-45085609 GCAGGGTCCTGTCTTGCAAGGGG + Intronic
1167804100 19:51767473-51767495 GCAAGGGATTGCTTTGGTAGTGG - Intronic
926277095 2:11412416-11412438 GGAAGGTCCTGCCTGGGCACTGG - Intergenic
929311901 2:40435264-40435286 GGAAGTGCTTGCCTTGGTAGTGG - Intronic
929458720 2:42085549-42085571 GCTAGGTCCTGCCTGGGCAGTGG - Intergenic
929779325 2:44947591-44947613 GGAAGGGCCTGCCTAGATAGAGG + Intergenic
934907594 2:98218932-98218954 GGAGGGTCTTGCCTCGGTAGTGG + Intronic
946096014 2:217274649-217274671 GCAGGGTCCTTCCTTGGGAAAGG - Intergenic
948373108 2:237503258-237503280 TCCAGGCCCTGCCTTGGCAGCGG - Intronic
948931797 2:241136868-241136890 CCAAGGTCCTTCCTGGGTAAAGG + Intronic
1169996183 20:11559184-11559206 GCAAGGACATGCCATGCTAGTGG + Intergenic
1175218149 20:57402298-57402320 GCGTGGCCCTGCCTTGGTGGTGG - Intronic
1178110554 21:29365688-29365710 GCCAGCTCCTGCCTTGGGAAGGG - Intronic
1179029654 21:37709659-37709681 TCAAGGTCCTGCCCTGCTAGTGG + Intronic
1179622633 21:42627354-42627376 GCCAGGTCCAGGCTTGGGAGAGG + Intergenic
1183056904 22:35312399-35312421 GCAAGGTCCTGCCCCAGTGGTGG - Intronic
1183538308 22:38415798-38415820 GGGAGGGCCTGCCCTGGTAGAGG - Intergenic
950572001 3:13807051-13807073 GGAAGGTCTTGCCTCAGTAGTGG - Intergenic
953108627 3:39910312-39910334 GCAGTGTACTGCCTTGGTACTGG - Intronic
954576700 3:51680315-51680337 GCGAGGTCTTGGCTTGGCAGGGG + Intronic
956395071 3:68816926-68816948 GGAAGGTCTTGCCTTGATATTGG + Intronic
956626190 3:71269041-71269063 GGAAGGGCCTGCATGGGTAGTGG - Intronic
956926013 3:73989528-73989550 GAAAGGTCTTGCCTTAATAGTGG + Intergenic
963508747 3:146221705-146221727 GCAAGGTCCTGCCTTGGTAGAGG - Intronic
964014581 3:151929501-151929523 GCAATGTCCGGGGTTGGTAGGGG - Intergenic
966642980 3:182210836-182210858 GCAAGGGCCTGCATTGGGGGAGG - Intergenic
970142278 4:12995727-12995749 GCAAGGCACTGCCATGGTGGTGG + Intergenic
970927375 4:21468364-21468386 GCAAGGTACTGCCTCGGTACCGG + Intronic
971620460 4:28848880-28848902 GCAGGGTCCTGCCTTAGCTGTGG + Intergenic
981476349 4:145190957-145190979 GAAAGGTCTTGCCTCAGTAGTGG - Intergenic
982058273 4:151575563-151575585 GCCAGGTACTCCCTGGGTAGGGG + Intronic
983228659 4:165108535-165108557 GAAAGGTCTTGCCTCAGTAGTGG - Intronic
984410985 4:179397768-179397790 GAAAGGTCTTGCCTCCGTAGTGG - Intergenic
984765182 4:183394804-183394826 GCTCAGTCCTGCCTTGGCAGTGG + Intergenic
988958215 5:36340959-36340981 GAAAGGTCTTGTCTTGGTAATGG + Intergenic
993366830 5:87044131-87044153 GAAAGGTCATGCCTTAGTAGTGG - Intergenic
993524609 5:88948821-88948843 GCAAGGTGCTTCCATGGCAGAGG - Intergenic
1000361168 5:160449003-160449025 GAAGGGTCTTGCCCTGGTAGAGG - Intergenic
1000829209 5:166082523-166082545 GCAAGGGCCTGAGTTGGTATTGG + Intergenic
1001928156 5:175654177-175654199 GCAAGGACCTGCCACGCTAGAGG - Intergenic
1003201614 6:3966369-3966391 GCACCATCCTGCCTTGGTACTGG + Intergenic
1003326303 6:5093941-5093963 GCAGGGTCCTGACTTGCCAGTGG + Intergenic
1005587210 6:27288458-27288480 GAAAAGTCCTGCCTGGGTTGAGG + Intronic
1005902387 6:30228194-30228216 ACAAATTCCTGCCTTGGTTGGGG - Intergenic
1006433950 6:34016308-34016330 GAAATGTCCTGCCCTGGTGGGGG + Intergenic
1006690211 6:35877187-35877209 GGAAGGTCTTGCCTCAGTAGAGG + Intronic
1010825262 6:80465223-80465245 GCATAGCCCTGCATTGGTAGTGG + Intergenic
1014430003 6:121358168-121358190 GCAAGGTACTGACTTAATAGGGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016318159 6:142812381-142812403 GAAAGGTCTTGCCTTGATAGTGG + Intronic
1018730886 6:166649652-166649674 GCAAGGCCTTGCCCTGGGAGTGG - Intronic
1019257982 7:63828-63850 GCAGGGCCCTGCCCCGGTAGAGG + Intergenic
1019289925 7:245430-245452 GCAGGGGCCAGCCTTGGTGGAGG + Intronic
1019289963 7:245533-245555 GCAGGGGCCGGCCTTGGTGGGGG + Intronic
1019289973 7:245563-245585 GCAGGGGCCGGCCTTGGTGGAGG + Intronic
1021777953 7:24072434-24072456 CCAATGTCCTGCCATGGTAGGGG + Intergenic
1022413108 7:30154619-30154641 GCAAGGTGGTGACTTGGCAGAGG + Intronic
1024634666 7:51277060-51277082 TCCAGGTGCTGCTTTGGTAGAGG - Intronic
1027026277 7:74854114-74854136 GCAAGGTCTTGCCTCATTAGAGG + Intergenic
1027061478 7:75090000-75090022 GCAAGGTCTTGCCTCATTAGAGG - Intergenic
1033309456 7:140250113-140250135 ACAATGTTGTGCCTTGGTAGGGG + Intergenic
1035377339 7:158414147-158414169 GCACGGTACTCACTTGGTAGAGG - Intronic
1041343018 8:56866072-56866094 GCAAGGGCCAGCCTTGCCAGTGG - Intergenic
1046077322 8:109328649-109328671 GGAAAGTCTTGCCTCGGTAGTGG + Intronic
1048861290 8:138726135-138726157 CCAAGCTCCTGTCTTGGTTGAGG + Intronic
1051629200 9:19127223-19127245 TCCAGGTCCTGGCTGGGTAGGGG - Intronic
1053395897 9:37774036-37774058 GCAAGGCCCTGTCTTGGACGGGG - Intronic
1059822917 9:117993998-117994020 GCAAGTTCCTCCCTTCTTAGTGG + Intergenic
1060163103 9:121384913-121384935 ACAAGGTCCTGTCTAGGTAAAGG + Intergenic
1186944919 X:14555212-14555234 GGAAGATCCTTCCTTGATAGGGG + Intronic
1191669123 X:63732665-63732687 GAAAGCCCCTGCCTTGTTAGAGG - Intronic
1194087091 X:89541611-89541633 ACAAATTCCTGCCTGGGTAGGGG - Intergenic
1197251077 X:124217031-124217053 GAAAGGTCCTGCCTTTAGAGAGG - Intronic
1197946546 X:131845321-131845343 GCAAGCACCTTCCTTGGTAATGG - Intergenic