ID: 963510156

View in Genome Browser
Species Human (GRCh38)
Location 3:146236684-146236706
Sequence GTCTTACGGTTCCACATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9048
Summary {0: 1, 1: 4, 2: 156, 3: 2477, 4: 6410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963510156_963510160 16 Left 963510156 3:146236684-146236706 CCAGTCATGTGGAACCGTAAGAC 0: 1
1: 4
2: 156
3: 2477
4: 6410
Right 963510160 3:146236723-146236745 TTTGTAAATTGCCCCATCTCAGG 0: 10
1: 84
2: 1520
3: 3320
4: 10995

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963510156 Original CRISPR GTCTTACGGTTCCACATGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr